Regulon of LexA in Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Properties
Regulator type:	Transcription factor
TF locus tag:	SSP1418
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Staphylococcaceae
Statistics of regulated genes:
- Genes	16
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 5.2 Sequence: ATACGAACAAACGTTCTAAG Locus tag: SSP1412 Name: sbcD Funciton: exonuclease SbcD Locus tag: SSP1411 Name: sbcC Funciton: exonuclease SbcC
	SSP1412	sbcD	exonuclease SbcD
	SSP1411	sbcC	exonuclease SbcC
Position: -66 Score: 5.3 Sequence: TTACGAAAGTATGTTCGCAT Locus tag: SSP0715 Name: SA1975 Funciton: predicted membrane-bound hydrolase Locus tag: SSP0716 Name: SA1974 Funciton: UDP-N-acetylglucosamine pyrophosphorylase Locus tag: SSP0717 Name: SA1973 Funciton: hemolysin III
	SSP0715	SA1975	predicted membrane-bound hydrolase
	SSP0716	SA1974	UDP-N-acetylglucosamine pyrophosphorylase
	SSP0717	SA1973	hemolysin III
Position: -135 Score: 5.1 Sequence: AACAGAACGTGTGTTCGTAT Locus tag: SSP0853 Name: SA1749 Funciton: hypothetical protein
	SSP0853	SA1749	hypothetical protein
Position: -125 Score: 5.1 Sequence: TACAGAACATTTGTTCGTGT Locus tag: SSP1988 Name: SA0684 Funciton: putative permease Locus tag: SSP1989 Name: SA0683 Funciton: 7-cyano-7-deazaguanine reductase
	SSP1988	SA0684	putative permease
	SSP1989	SA0683	7-cyano-7-deazaguanine reductase
Position: -104 Score: 5.1 Sequence: TAGCGAACAAATATTCGCAA Locus tag: SSP1480 Name: recA Funciton: recombinase A
	SSP1480	recA	recombinase A
Position: -33 Score: 5.4 Sequence: AAACGAACGTACGTTTGTAG Locus tag: SSP1404 Name: parE Funciton: DNA topoisomerase IV subunit B Locus tag: SSP1403 Name: parC Funciton: DNA topoisomerase IV subunit A
	SSP1404	parE	DNA topoisomerase IV subunit B
	SSP1403	parC	DNA topoisomerase IV subunit A
Position: -131 Score: 4.7 Sequence: CCTAGAACGTTTGTTTGTAT Position: -102 Score: 4.9 Sequence: ATCAGAACATTTGTTCTATG Position: -73 Score: 5.5 Sequence: AAACGAACAAACGTTTGTAA Locus tag: SSP1418 Name: null Funciton: SOS regulatory LexA protein
	SSP1418		SOS regulatory LexA protein
Position: -51 Score: 5.6 Sequence: AATAGAACGTATGTTCGTAT Locus tag: SSP0868 Name: null Funciton: SPBc2 prophage-derived uncharacterized protein
	SSP0868		SPBc2 prophage-derived uncharacterized protein
Position: -80 Score: 5.1 Sequence: ATTGGAACATTTGTTCTTAT Position: -51 Score: 5.6 Sequence: AATAGAACATTTGTTCGTAT Locus tag: SSP1388 Name: uvrX Funciton: Putative UV-damage repair protein
	SSP1388	uvrX	Putative UV-damage repair protein
Position: -176 Score: 5.6 Sequence: CTACGAACAAATGTTTGTTT Locus tag: SSP1959 Name: uvrB Funciton: excinuclease ABC subunit B Locus tag: SSP1958 Name: uvrA Funciton: exinuclease ABC subunit A
	SSP1959	uvrB	excinuclease ABC subunit B
	SSP1958	uvrA	exinuclease ABC subunit A

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Staphylococcus saprophyticus subsp. saprophyticus ATCC 15305

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --