Regulon of LexA in Staphylococcus haemolyticus JCSC1435

Properties
Regulator type:	Transcription factor
TF locus tag:	SH1568
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Staphylococcaceae
Statistics of regulated genes:
- Genes	16
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -39 Score: 5.4 Sequence: ATgCGAACATATGTTCtata Locus tag: SH0364 Name: null Funciton: SPBc2 prophage-derived uncharacterized protein
	SH0364		SPBc2 prophage-derived uncharacterized protein
Position: -81 Score: 4.9 Sequence: TAAAGAACATTAGTTCTTAT Position: -52 Score: 5.8 Sequence: AAAAGAACAAATGTTCGTAT Locus tag: SH1545 Name: uvrX Funciton: Putative UV-damage repair protein
	SH1545	uvrX	Putative UV-damage repair protein
Position: -266 Score: 5.5 Sequence: AAGCGAACAAACGTTTGTAT Locus tag: SH2131 Name: uvrB Funciton: excinuclease ABC subunit B Locus tag: SH2130 Name: uvrA Funciton: exinuclease ABC subunit A
	SH2131	uvrB	excinuclease ABC subunit B
	SH2130	uvrA	exinuclease ABC subunit A
Position: -31 Score: 5.2 Sequence: ACACGAACAAATGTTCTAAA Locus tag: SH1562 Name: sbcD Funciton: exonuclease SbcD Locus tag: SH1561 Name: sbcC Funciton: exonuclease SbcC
	SH1562	sbcD	exonuclease SbcD
	SH1561	sbcC	exonuclease SbcC
Position: -66 Score: 5.2 Sequence: CACCGAAAATATGTTCGTAT Locus tag: SH0869 Name: SA1975 Funciton: predicted membrane-bound hydrolase Locus tag: SH0870 Name: SA1974 Funciton: UDP-N-acetylglucosamine pyrophosphorylase Locus tag: SH0871 Name: SA1973 Funciton: hemolysin III
	SH0869	SA1975	predicted membrane-bound hydrolase
	SH0870	SA1974	UDP-N-acetylglucosamine pyrophosphorylase
	SH0871	SA1973	hemolysin III
Position: -129 Score: 5.9 Sequence: AAACGAACAAATGTTCGCTT Locus tag: SH1018 Name: SA1749 Funciton: hypothetical protein
	SH1018	SA1749	hypothetical protein
Position: -124 Score: 5.6 Sequence: AACAGAACATTTGTTCGTAT Locus tag: SH2164 Name: SA0684 Funciton: putative permease Locus tag: SH2165 Name: SA0683 Funciton: 7-cyano-7-deazaguanine reductase
	SH2164	SA0684	putative permease
	SH2165	SA0683	7-cyano-7-deazaguanine reductase
Position: -105 Score: 5.2 Sequence: AAGCGAACAAATATTCGCAA Locus tag: SH1628 Name: recA Funciton: recombinase A
	SH1628	recA	recombinase A
Position: -32 Score: 5.4 Sequence: AAACGAACGTACGTTTGTAG Locus tag: SH1554 Name: parE Funciton: DNA topoisomerase IV subunit B Locus tag: SH1553 Name: parC Funciton: DNA topoisomerase IV subunit A
	SH1554	parE	DNA topoisomerase IV subunit B
	SH1553	parC	DNA topoisomerase IV subunit A
Position: -132 Score: 5 Sequence: TCTAGAACATTTGTTTGTAT Position: -103 Score: 4.8 Sequence: AACAGAACATCTGTTCTTAG Position: -74 Score: 5.4 Sequence: AAACGAACAAATGTTTGTTC Locus tag: SH1568 Name: lexA Funciton: SOS regulatory LexA protein
	SH1568	lexA	SOS regulatory LexA protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Staphylococcus haemolyticus JCSC1435

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --