Regulon of LexA in Staphylococcus epidermidis ATCC 12228

Properties
Regulator type:	Transcription factor
TF locus tag:	SE1022
Regulator family:	LexA
Regulation mode:	repressor
Biological process:	SOS response
Effector:	DNA damage
Regulog:	LexA - Staphylococcaceae
Statistics of regulated genes:
- Genes	16
- Operons	10
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 85 sites [see more]

Member of regulog collections

By taxonomy - Staphylococcaceae
By trascription factor - LexA
By TF family - LexA
By effector - DNA damage
By pathway - SOS response

Regulated operons
	Locus Tag	Name	Function
Position: -52 Score: 5.6 Sequence: AACAGAACAAATGTTCGTAT Locus tag: SE1605 Name: null Funciton: SPBc2 prophage-derived uncharacterized protein
	SE1605		SPBc2 prophage-derived uncharacterized protein
Position: -77 Score: 5.7 Sequence: ATAAGAACAAATGTTCTTAT Position: -48 Score: 4.7 Sequence: AATAGAACACGTGTTCTTAT Locus tag: SE1046 Name: uvrX Funciton: Putative UV-damage repair protein
	SE1046	uvrX	Putative UV-damage repair protein
Position: -33 Score: 5.2 Sequence: TAACGAACGTACGTTTGTAG Locus tag: SE1036 Name: parE Funciton: DNA topoisomerase IV subunit B Locus tag: SE1037 Name: parC Funciton: DNA topoisomerase IV subunit A
	SE1036	parE	DNA topoisomerase IV subunit B
	SE1037	parC	DNA topoisomerase IV subunit A
Position: -517 Score: 4.9 Sequence: cctaGAACATtTGTTtGTAT Position: -459 Score: 5.5 Sequence: tTACGAACAaATGTTtGTta Locus tag: SE1022 Name: lexA Funciton: SOS regulatory LexA protein
	SE1022	lexA	SOS regulatory LexA protein
Position: -145 Score: 5.1 Sequence: ATAAGTACGTTTGTTCGTTT Position: -102 Score: 5.4 Sequence: ATACGAACAAATATTCGCAA Locus tag: SE0963 Name: recA Funciton: recombinase A
	SE0963	recA	recombinase A
Position: -130 Score: 5.7 Sequence: AAGCGAACAAATGTTTGTAT Locus tag: SE0541 Name: uvrB Funciton: excinuclease ABC subunit B Locus tag: SE0542 Name: uvrA Funciton: exinuclease ABC subunit A
	SE0541	uvrB	excinuclease ABC subunit B
	SE0542	uvrA	exinuclease ABC subunit A
Position: -33 Score: 5.7 Sequence: AAACGAACAAACGTTCTTAT Locus tag: SE1028 Name: sbcD Funciton: exonuclease SbcD Locus tag: SE1029 Name: sbcC Funciton: exonuclease SbcC
	SE1028	sbcD	exonuclease SbcD
	SE1029	sbcC	exonuclease SbcC
Position: -66 Score: 5.1 Sequence: GTACGAAAGTATGTTCGCAT Locus tag: SE1762 Name: SA1975 Funciton: predicted membrane-bound hydrolase Locus tag: SE1761 Name: SA1974 Funciton: UDP-N-acetylglucosamine pyrophosphorylase Locus tag: SE1760 Name: SA1973 Funciton: hemolysin III
	SE1762	SA1975	predicted membrane-bound hydrolase
	SE1761	SA1974	UDP-N-acetylglucosamine pyrophosphorylase
	SE1760	SA1973	hemolysin III
Position: -127 Score: 5.1 Sequence: AACAGAACGTATGTTCTGTT Locus tag: SE1627 Name: SA1749 Funciton: hypothetical protein
	SE1627	SA1749	hypothetical protein
Position: -116 Score: 5.9 Sequence: AAGCGAACATTTGTTCGTTT Locus tag: SE0511 Name: SA0684 Funciton: putative permease Locus tag: SE0510 Name: SA0683 Funciton: 7-cyano-7-deazaguanine reductase
	SE0511	SA0684	putative permease
	SE0510	SA0683	7-cyano-7-deazaguanine reductase

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of LexA in Staphylococcus epidermidis ATCC 12228

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --