Regulon of CymR in Clostridium tetani E88

Properties
Regulator type:	Transcription factor
TF locus tag:	CTC01344
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:
Regulog:	CymR - Clostridia-1
Statistics of regulated genes:
- Genes	1
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - Rrf2
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -40 Score: 5.8 Sequence: ATAATCATACTAAACATATAGGAATAG Locus tag: CTC01344 Name: cymR Funciton: Predicted transcriptional regulator of cysteine synthase, Rrf2 family
	CTC01344	cymR	Predicted transcriptional regulator of cysteine synthase, Rrf2 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD