Regulon of CymR in Clostridium botulinum A str. ATCC 3502

Properties
Regulator type:	Transcription factor
TF locus tag:	CBO1178
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:
Regulog:	CymR - Clostridia-1
Statistics of regulated genes:
- Genes	4
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - Rrf2
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -303 Score: 5.9 Sequence: GAATACCTAGTAAACAAATAAGAATAA Locus tag: CBO1179 Name: cysK Funciton: Cysteine synthase (EC 2.5.1.47) Locus tag: CBO1180 Name: CAC0878 Funciton: Cysteine ABC transporter permease component Locus tag: CBO1181 Name: CAC0880 Funciton: Cysteine ABC transporter, substrate-binding protein
	CBO1179	cysK	Cysteine synthase (EC 2.5.1.47)
	CBO1180	CAC0878	Cysteine ABC transporter permease component
	CBO1181	CAC0880	Cysteine ABC transporter, substrate-binding protein
Position: -45 Score: 5.7 Sequence: ATAATCATAGTAAATAGATAGGAATAC Locus tag: CBO1178 Name: cymR Funciton: Predicted transcriptional regulator of cysteine synthase, Rrf2 family
	CBO1178	cymR	Predicted transcriptional regulator of cysteine synthase, Rrf2 family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD