Regulon of CymR in Clostridium beijerincki NCIMB 8052

Properties
Regulator type:	Transcription factor
TF locus tag:	Cbei_1748
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:
Regulog:	CymR - Clostridia-1
Statistics of regulated genes:
- Genes	5
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - Rrf2
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -98 Score: 5.8 Sequence: AAAATCCTACTAAACATATATGAATAT Locus tag: Cbei_4193 Name: sbpA Funciton: Sulfate-binding protein Sbp
	Cbei_4193	sbpA	Sulfate-binding protein Sbp
Position: -140 Score: 5.7 Sequence: TAAAACACAGTAAACAAATAAGAATAA Locus tag: Cbei_0629 Name: mccB Funciton: Cystathionine gamma-lyase (EC 4.4.1.1) Locus tag: Cbei_0630 Name: null Funciton: Cystathionine beta-synthase (EC 4.2.1.22)
	Cbei_0629	mccB	Cystathionine gamma-lyase (EC 4.4.1.1)
	Cbei_0630		Cystathionine beta-synthase (EC 4.2.1.22)
Position: -48 Score: 5.3 Sequence: ATAAATATACTAATTATATAGGAATTG Locus tag: Cbei_4344 Name: tcyP Funciton: L-cystine uptake protein TcyP
	Cbei_4344	tcyP	L-cystine uptake protein TcyP
Position: -170 Score: 5.3 Sequence: TAATTCCCATTGAAATAATAGGAATTA Locus tag: Cbei_4194 Name: sbpA Funciton: Sulfate-binding protein Sbp
	Cbei_4194	sbpA	Sulfate-binding protein Sbp

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD