Regulon of CymR in Clostridium acetobutylicum ATCC 824

Properties
Regulator type:	Transcription factor
TF locus tag:	CAC2236
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Cysteine metabolism
Effector:
Regulog:	CymR - Clostridia-1
Statistics of regulated genes:
- Genes	20
- Operons	6
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - Rrf2
By pathway - Cysteine metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -277 Score: 5.7 Sequence: ATATTCATATTAATATAGTAGGAATTA Position: -77 Score: 5 Sequence: CATTACATAGTAAAGTAATATGTTTTA Locus tag: CAC0102 Name: metY Funciton: O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48) Locus tag: CAC0103 Name: cysC Funciton: Adenylylsulfate kinase (EC 2.7.1.25) Locus tag: CAC0104 Name: aprA Funciton: Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2) Locus tag: CAC0105 Name: aprB Funciton: Adenylylsulfate reductase beta-subunit (EC 1.8.99.2) Locus tag: CAC0106 Name: null Funciton: ABC-type probable sulfate transporter, periplasmic binding protein Locus tag: CAC0107 Name: null Funciton: ABC-type probable sulfate transporter, ATPase component Locus tag: CAC0108 Name: null Funciton: ABC-type nitrate/sulfonate/bicarbonate transport system, permease component Locus tag: CAC0109 Name: cysD Funciton: Sulfate adenylyltransferase subunit 2 (EC 2.7.7.4) Locus tag: CAC0110 Name: cysN Funciton: Sulfate adenylyltransferase subunit 1 (EC 2.7.7.4)
	CAC0102	metY	O-acetylhomoserine sulfhydrylase (EC 2.5.1.49) / O-succinylhomoserine sulfhydrylase (EC 2.5.1.48)
	CAC0103	cysC	Adenylylsulfate kinase (EC 2.7.1.25)
	CAC0104	aprA	Adenylylsulfate reductase alpha-subunit (EC 1.8.99.2)
	CAC0105	aprB	Adenylylsulfate reductase beta-subunit (EC 1.8.99.2)
	CAC0106		ABC-type probable sulfate transporter, periplasmic binding protein
	CAC0107		ABC-type probable sulfate transporter, ATPase component
	CAC0108		ABC-type nitrate/sulfonate/bicarbonate transport system, permease component
	CAC0109	cysD	Sulfate adenylyltransferase subunit 2 (EC 2.7.7.4)
	CAC0110	cysN	Sulfate adenylyltransferase subunit 1 (EC 2.7.7.4)
Position: -70 Score: 5.8 Sequence: TTAAACATATTAGTTTAGTAGGTATTT Locus tag: CAC0878 Name: CAC0878 Funciton: Cysteine ABC transporter permease component Locus tag: CAC0879 Name: CAC0879 Funciton: Cysteine ABC transporter, ATPase component Locus tag: CAC0880 Name: CAC0880 Funciton: Cysteine ABC transporter, substrate-binding protein
	CAC0878	CAC0878	Cysteine ABC transporter permease component
	CAC0879	CAC0879	Cysteine ABC transporter, ATPase component
	CAC0880	CAC0880	Cysteine ABC transporter, substrate-binding protein
Position: -86 Score: 5.3 Sequence: AAAATTCTACTTGACAAGTAAAATTTT Locus tag: CAC2236 Name: cymR Funciton: Predicted transcriptional regulator of cysteine synthase, Rrf2 family
	CAC2236	cymR	Predicted transcriptional regulator of cysteine synthase, Rrf2 family
Position: -354 Score: 5.6 Sequence: GTATACCTACTTGTATACTAGGAATAT Locus tag: CAC3325 Name: CAC3325 Funciton: L-Cystine ABC transporter, periplasmic cystine-binding protein TcyA Locus tag: CAC3326 Name: CAC3326 Funciton: L-Cystine ABC transporter, permease protein TcyB Locus tag: CAC3327 Name: CAC3327 Funciton: L-Cystine ABC transporter, ATP-binding protein TcyC
	CAC3325	CAC3325	L-Cystine ABC transporter, periplasmic cystine-binding protein TcyA
	CAC3326	CAC3326	L-Cystine ABC transporter, permease protein TcyB
	CAC3327	CAC3327	L-Cystine ABC transporter, ATP-binding protein TcyC
Position: -49 Score: 5.8 Sequence: ATATTCCTAGTAAACAAATGTGTTTAA Locus tag: CAC2235 Name: cysK Funciton: Cysteine synthase (EC 2.5.1.47)
	CAC2235	cysK	Cysteine synthase (EC 2.5.1.47)
Position: -473 Score: 5.4 Sequence: AAAAACCTACTTATCAGATATGAAAAA Locus tag: CAC0929 Name: ubiG Funciton: SAM-dependent methlytransferase UbiG Locus tag: CAC0930 Name: mccB Funciton: Cystathionine gamma-lyase (EC 4.4.1.1) Locus tag: CAC0931 Name: null Funciton: Cystathionine beta-synthase (EC 4.2.1.22)
	CAC0929	ubiG	SAM-dependent methlytransferase UbiG
	CAC0930	mccB	Cystathionine gamma-lyase (EC 4.4.1.1)
	CAC0931		Cystathionine beta-synthase (EC 4.2.1.22)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --

Regulon of CymR in Clostridium acetobutylicum ATCC 824

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes
-- version 3.2 --