Regulon of IscR in Dorea longicatena DSM 13814

Properties
Regulator type:	Transcription factor
TF locus tag:	DORLON_02444
Regulator family:	Rrf2
Regulation mode:	repressor
Biological process:	Iron-sulfur cluster biogenesis
Effector:	Iron-sulfur cluster redox state
Regulog:	IscR - Clostridia-3
Statistics of regulated genes:
- Genes	5
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 9 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-3
By TF family - Rrf2
By effector - Iron-sulfur cluster redox state
By pathway - Iron-sulfur cluster biogenesis

Regulated operons
	Locus Tag	Name	Function
Position: -43 Score: 5.4 Sequence: AAAAATCCTAGTAAAATACTGGGGATTAA Locus tag: DORLON_02444 Name: iscR Funciton: Iron-sulfur cluster assembly transcription factor IscR Locus tag: DORLON_02443 Name: null Funciton: hypothetical protein Locus tag: DORLON_02442 Name: iscS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: DORLON_02441 Name: iscU Funciton: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like Locus tag: DORLON_02440 Name: trmU Funciton: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)
	DORLON_02444	iscR	Iron-sulfur cluster assembly transcription factor IscR
	DORLON_02443		hypothetical protein
	DORLON_02442	iscS	Cysteine desulfurase (EC 2.8.1.7)
	DORLON_02441	iscU	Iron-sulfur cluster assembly scaffold protein IscU/NifU-like
	DORLON_02440	trmU	tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD