Regulog IscR - Clostridia-3
| Regulator type: | Transcription factor |
| Regulator family: | Rrf2 |
| Regulation mode: | repressor |
| Biological process: | Iron-sulfur cluster biogenesis |
| Effector: | Iron-sulfur cluster redox state |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-3
- By TF family - Rrf2
- By effector - Iron-sulfur cluster redox state
- By pathway - Iron-sulfur cluster biogenesis
| Genome | Genes | Operons |
|---|---|---|
| Bacteroides pectinophilus ATCC 43243 | ||
| Blautia hansenii DSM 20583 | 4 | 1 |
| Bryantella formatexigens DSM 14469 | 4 | 1 |
| Clostridiales bacterium 1_7_47_FAA | ||
| Clostridium bolteae ATCC BAA-613 | ||
| Clostridium nexile DSM 1787 | 4 | 1 |
| Clostridium scindens ATCC 35704 | 4 | 1 |
| Dorea formicigenerans ATCC 27755 | 4 | 1 |
| Dorea longicatena DSM 13814 | 5 | 1 |
| Eubacterium eligens ATCC 27750 | ||
| Eubacterium rectale ATCC 33656 | 4 | 1 |
| Roseburia intestinalis L1-82 | ||
| Ruminococcus gnavus ATCC 29149 | 4 | 1 |
| Ruminococcus lactaris ATCC 29176 | 4 | 1 |
| Genes | Function | ||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||
| iscR |
|
*
Blautia hansenii DSM 20583 Site: position = -43 score = 5.57175 sequence = AGAAATCAGAGTAAAACAGTCGGAATTGA Gene: BLAHAN_03017: Iron-sulfur cluster assembly transcription factor IscR |
*
Bryantella formatexigens DSM 14469 Site: position = -53 score = 6.20065 sequence = AGAAATCCGAGTAATTTAGTAGGATTTAA Gene: BRYFOR_01246: Iron-sulfur cluster assembly transcription factor IscR |
|
|
*
Clostridium nexile DSM 1787 Site: position = -51 score = 5.91229 sequence = ATAAACCCTAGTAATTCACTAGGAATTAA Gene: CLONEX_03012: Iron-sulfur cluster assembly transcription factor IscR |
*
Clostridium scindens ATCC 35704 Site: position = 18 score = 5.74359 sequence = AGAAATCCTAGCAAATTGCTAGGAATTAA Gene: CLOSCI_01399: Iron-sulfur cluster assembly transcription factor IscR |
*
Dorea formicigenerans ATCC 27755 Site: position = -37 score = 4.69748 sequence = TAAATCCCCAGTATTTTGCTAGGGATTGG Gene: DORFOR_01426: Iron-sulfur cluster assembly transcription factor IscR |
*
Dorea longicatena DSM 13814 Site: position = -43 score = 5.39194 sequence = AAAAATCCTAGTAAAATACTGGGGATTAA Gene: DORLON_02444: Iron-sulfur cluster assembly transcription factor IscR |
|
*
Eubacterium rectale ATCC 33656 Site: position = -45 score = 5.32536 sequence = TGAATGTATAGTAAAGCAGTAGGAAATGA Gene: EUBREC_0307: Iron-sulfur cluster assembly transcription factor IscR |
|
*
Ruminococcus gnavus ATCC 29149 Site: position = -60 score = 4.49887 sequence = GGAAATCCTAGTAAAACAATAGGGATTGG Gene: RUMGNA_01751: Iron-sulfur cluster assembly transcription factor IscR |
*
Ruminococcus lactaris ATCC 29176 Site: position = -54 score = 4.58676 sequence = GAAAATCCTAGTACAATACTAGGGATAAT Gene: RUMLAC_01913: Iron-sulfur cluster assembly transcription factor IscR |
Iron-sulfur cluster assembly transcription factor IscR |
| DORLON_02443 |
|
|
|
|
|
|
|
|
Gene: DORLON_02443: hypothetical protein |
|
|
|
|
|
hypothetical protein |
| iscS |
|
Gene: BLAHAN_03016: Cysteine desulfurase (EC 2.8.1.7) |
Gene: BRYFOR_01247: Cysteine desulfurase (EC 2.8.1.7) |
|
|
Gene: CLONEX_03011: Cysteine desulfurase (EC 2.8.1.7) |
Gene: CLOSCI_01400: Cysteine desulfurase (EC 2.8.1.7) |
Gene: DORFOR_01427: Cysteine desulfurase (EC 2.8.1.7) |
Gene: DORLON_02442: Cysteine desulfurase (EC 2.8.1.7) |
|
Gene: EUBREC_0308: Cysteine desulfurase (EC 2.8.1.7) |
|
Gene: RUMGNA_01752: Cysteine desulfurase (EC 2.8.1.7) |
Gene: RUMLAC_01914: Cysteine desulfurase (EC 2.8.1.7) |
Cysteine desulfurase (EC 2.8.1.7) |
| iscU |
|
Gene: BLAHAN_03015: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Gene: BRYFOR_01248: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
|
|
Gene: CLONEX_03010: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Gene: CLOSCI_01401: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Gene: DORFOR_01428: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Gene: DORLON_02441: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
|
Gene: EUBREC_0309: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
|
Gene: RUMGNA_01753: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Gene: RUMLAC_01915: Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
Iron-sulfur cluster assembly scaffold protein IscU/NifU-like |
| trmU |
|
Gene: BLAHAN_03014: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Gene: BRYFOR_01249: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
|
|
Gene: CLONEX_03009: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Gene: CLOSCI_01402: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Gene: DORFOR_01429: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Gene: DORLON_02440: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
|
Gene: EUBREC_0310: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
|
Gene: RUMGNA_01754: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Gene: RUMLAC_01916: tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase (EC 2.1.1.61) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |