Regulon of Mce2R in Mycobacterium sp. JLS

Properties
Regulator type:	Transcription factor
TF locus tag:	Mjls_2757
Regulator family:	GntR/Others
Regulation mode:
Biological process:	Fatty acid metabolism
Effector:
Regulog:	Mce2R - Mycobacteriaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Mycobacteriaceae
By TF family - GntR/Others
By pathway - Fatty acid metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -54 Score: 6.2 Sequence: CTAACTGGTCAGACCACTTGA Locus tag: Mjls_2757 Name: mce2R Funciton: Putative transcriptional regulator, GntR family Locus tag: Mjls_2758 Name: fah Funciton: Fatty acid hydroxylase FAH1P
	Mjls_2757	mce2R	Putative transcriptional regulator, GntR family
	Mjls_2758	fah	Fatty acid hydroxylase FAH1P

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD