Regulog Mce2R - Mycobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | Fatty acid metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Mycobacteriaceae
- By TF family - GntR/Others
- By pathway - Fatty acid metabolism
| Genome | Genes | Operons |
|---|---|---|
| Mycobacterium abscessus ATCC 19977 | 2 | 1 |
| Mycobacterium avium 104 | ||
| Mycobacterium flavescens PYR-GCK | ||
| Mycobacterium leprae TN | ||
| Mycobacterium marinum M | ||
| Mycobacterium smegmatis str. MC2 155 | 2 | 1 |
| Mycobacterium sp. JLS | 2 | 1 |
| Mycobacterium tuberculosis H37Rv | 10 | 1 |
| Mycobacterium vanbaalenii PYR-1 | 2 | 1 |
| Genes | Function | |||||||||
|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | ||||||||||
| mce2R |
*
Mycobacterium abscessus ATCC 19977 Site: position = -52 score = 5.92146 sequence = TAAATTGGTCAGACCACTAGA Gene: MAB_3018: Putative transcriptional regulator, GntR family |
|
|
|
|
*
Mycobacterium smegmatis str. MC2 155 Site: position = -52 score = 5.85285 sequence = ACCACTGGTAAGACCACTTGA Gene: MSMEG_3527: Putative transcriptional regulator, GntR family |
*
Mycobacterium sp. JLS Site: position = -54 score = 6.15593 sequence = CTAACTGGTCAGACCACTTGA Gene: Mjls_2757: Putative transcriptional regulator, GntR family |
*
Mycobacterium tuberculosis H37Rv Site: position = -52 score = 5.3435 sequence = GGTGTCGGTCTGACCACTTGA Gene: Rv0586: Putative transcriptional regulator, GntR family |
*
Mycobacterium vanbaalenii PYR-1 Site: position = -54 score = 5.86581 sequence = CACACTGGTCTGACCACTTGA Gene: Mvan_2942: Putative transcriptional regulator, GntR family |
Putative transcriptional regulator, GntR family |
| yrbE2A |
|
Gene: MAV_4553: hypothetical protein |
|
|
|
|
|
Gene: Rv0587: hypothetical protein Rv0587 |
|
hypothetical protein |
| yrbE2B |
|
Gene: MAV_4552: hypothetical protein Rv0588 |
|
|
|
|
|
Gene: Rv0588: hypothetical protein Rv0588 |
|
hypothetical protein Rv0588 |
| mce2A |
|
Gene: MAV_4551: MCE-family protein Mce2A |
|
|
|
|
|
Gene: Rv0589: MCE-family protein Mce2A |
|
MCE-family protein Mce2A |
| mce2B |
|
Gene: MAV_4550: virulence factor mce family protein |
|
|
|
|
|
Gene: Rv0590: virulence factor mce family protein |
|
virulence factor mce family protein |
| Rv0590A |
|
|
|
|
|
|
|
Gene: Rv0590A: MCE-FAMILY RELATED PROTEIN |
|
MCE-FAMILY RELATED PROTEIN |
| mce2C |
|
Gene: MAV_4549: Virulence factor mce family protein |
|
|
|
|
|
Gene: Rv0591: Virulence factor mce family protein |
|
Virulence factor mce family protein |
| mce2D |
|
Gene: MAV_4548: virulence factor mce family protein |
|
|
|
|
|
Gene: Rv0592: virulence factor mce family protein |
|
virulence factor mce family protein |
| lprL |
|
Gene: MAV_4547: virulence factor Mce family protein |
|
|
|
|
|
Gene: Rv0593: virulence factor Mce family protein |
|
virulence factor Mce family protein |
| mce2F |
|
Gene: MAV_4546: virulence factor mce family protein |
|
|
|
|
|
Gene: Rv0594: virulence factor mce family protein |
|
virulence factor mce family protein |
| fah |
Gene: MAB_3019: Fatty acid hydroxylase FAH1P |
|
|
|
|
Gene: MSMEG_3529: Fatty acid hydroxylase FAH1P |
Gene: Mjls_2758: Fatty acid hydroxylase FAH1P |
|
Gene: Mvan_2943: Fatty acid hydroxylase FAH1P |
Fatty acid hydroxylase FAH1P |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |