Regulon of NrtR in Bifidobacterium longum NCC2705

Properties
Regulator type:	Transcription factor
TF locus tag:	BL1373
Regulator family:	NrtR
Regulation mode:
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Bifidobacteriaceae
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -75 Score: 6.4 Sequence: TTATGGTCATTGTGACTATAA Locus tag: BL1373 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR Locus tag: BL1374 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: BL1375 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: BL1376 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) Locus tag: BL1377 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7) Locus tag: BL1378 Name: niaP Funciton: Niacin transporter NiaP
	BL1373	nrtR	Nudix-related transcriptional regulator NrtR
	BL1374	nadA	Quinolinate synthetase (EC 4.1.99.-)
	BL1375	nadB	L-aspartate oxidase (EC 1.4.3.16)
	BL1376	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	BL1377	sufS	Cysteine desulfurase (EC 2.8.1.7)
	BL1378	niaP	Niacin transporter NiaP

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD