Regulon of NrtR in Bifidobacterium animalis subsp. lactis AD011
| Regulator type: | Transcription factor |
| TF locus tag: | BLA_0733 |
| Regulator family: | NrtR |
| Regulation mode: | |
| Biological process: | NAD biosynthesis |
| Effector: | Adenosine diphosphate ribose |
| Regulog: | NrtR - Bifidobacteriaceae |
| Statistics of regulated genes: | |
| - Genes | 2 |
| - Operons | 1 |
| Visualization: | |
|
Allows to visualize regulon content in the context of metabolic pathways |
Member of regulog collections
- By trascription factor - NrtR
- By taxonomy - Bifidobacteriaceae
- By TF family - NrtR
- By effector - Adenosine diphosphate ribose
- By pathway - NAD biosynthesis
| Locus Tag | Name | Function | |
|---|---|---|---|
|
Position: -105
Score: 6.2 Sequence: TAATAGTCATAGTGACTATTA
Locus tag: BLA_0733
Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR
Locus tag: BLA_0732
Name: niaP Funciton: Niacin transporter NiaP |
|||
|
nrtR
|
Nudix-related transcriptional regulator NrtR
|
||
|
niaP
|
Niacin transporter NiaP
|
||
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |