Regulon of NrtR in Bifidobacterium animalis subsp. lactis AD011

Properties
Regulator type:	Transcription factor
TF locus tag:	BLA_0733
Regulator family:	NrtR
Regulation mode:
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Bifidobacteriaceae
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: -105 Score: 6.2 Sequence: TAATAGTCATAGTGACTATTA Locus tag: BLA_0733 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR Locus tag: BLA_0732 Name: niaP Funciton: Niacin transporter NiaP
	BLA_0733	nrtR	Nudix-related transcriptional regulator NrtR
	BLA_0732	niaP	Niacin transporter NiaP

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD