Regulon of NrtR in Bifidobacterium angulatum DSM 20098

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFANG_01628
Regulator family:	NrtR
Regulation mode:
Biological process:	NAD biosynthesis
Effector:	Adenosine diphosphate ribose
Regulog:	NrtR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 8 sites [see more]

Member of regulog collections

By trascription factor - NrtR
By taxonomy - Bifidobacteriaceae
By TF family - NrtR
By effector - Adenosine diphosphate ribose
By pathway - NAD biosynthesis

Regulated operons
	Locus Tag	Name	Function
Position: 47 Score: 6.4 Sequence: TTATGGTCAGTGTGACTATAA Locus tag: BIFANG_01628 Name: nrtR Funciton: Nudix-related transcriptional regulator NrtR Locus tag: BIFANG_01627 Name: null Funciton: hypothetical protein Locus tag: BIFANG_01626 Name: nadA Funciton: Quinolinate synthetase (EC 4.1.99.-) Locus tag: BIFANG_01625 Name: nadB Funciton: L-aspartate oxidase (EC 1.4.3.16) Locus tag: BIFANG_01624 Name: nadC Funciton: Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19) Locus tag: BIFANG_01623 Name: sufS Funciton: Cysteine desulfurase (EC 2.8.1.7)
	BIFANG_01628	nrtR	Nudix-related transcriptional regulator NrtR
	BIFANG_01627		hypothetical protein
	BIFANG_01626	nadA	Quinolinate synthetase (EC 4.1.99.-)
	BIFANG_01625	nadB	L-aspartate oxidase (EC 1.4.3.16)
	BIFANG_01624	nadC	Quinolinate phosphoribosyltransferase [decarboxylating] (EC 2.4.2.19)
	BIFANG_01623	sufS	Cysteine desulfurase (EC 2.8.1.7)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD