Regulon of BgrT8 in Bifidobacterium animalis subsp. lactis AD011

Properties
Regulator type:	Transcription factor
TF locus tag:	BLA_0894
Regulator family:	TetR
Regulation mode:
Biological process:	Beta-glucosides utilization
Effector:
Regulog:	BgrT8 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 1 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - TetR
By pathway - Beta-glucosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -154 Score: 4.4 Sequence: AGGTGACGCGTTGCTCACTC Locus tag: BLA_0894 Name: bgrT8 Funciton: Predicted beta-glucoside specific transcriptional regulator, TetR family Locus tag: BLA_0893 Name: bglX3 Funciton: Beta-glucosidase (EC 3.2.1.21)
	BLA_0894	bgrT8	Predicted beta-glucoside specific transcriptional regulator, TetR family
	BLA_0893	bglX3	Beta-glucosidase (EC 3.2.1.21)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD