Regulog BgrT8 - Bifidobacteriaceae

Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - TetR
- By pathway - Beta-glucosides utilization
Genome | Genes | Operons |
---|---|---|
Bifidobacterium adolescentis ATCC 15703 | ||
Bifidobacterium angulatum DSM 20098 | ||
Bifidobacterium animalis subsp. lactis AD011 | 2 | 1 |
Bifidobacterium bifidum NCIMB 41171 | ||
Bifidobacterium breve DSM 20213 | ||
Bifidobacterium dentium Bd1 | ||
Bifidobacterium gallicum DSM 20093 | ||
Bifidobacterium longum NCC2705 | ||
Bifidobacterium longum subsp. infantis ATCC 15697 | ||
Gardnerella vaginalis 409-05 |
Genes | Function | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | |||||||||||
bgrT8 |
|
|
*
Bifidobacterium animalis subsp. lactis AD011 Site: position = -154 score = 4.41526 sequence = AGGTGACGCGTTGCTCACTC Gene: BLA_0894: Predicted beta-glucoside specific transcriptional regulator, TetR family |
|
|
|
|
|
|
|
Predicted beta-glucoside specific transcriptional regulator, TetR family |
bglX3 |
Gene: BAD_1197: Beta-glucosidase (EC 3.2.1.21) |
Gene: BIFANG_00887: Beta-glucosidase (EC 3.2.1.21) |
Gene: BLA_0893: Beta-glucosidase (EC 3.2.1.21) |
|
Gene: BIFBRE_00462: Beta-glucosidase (EC 3.2.1.21) |
Gene: BDP_1671: Beta-glucosidase (EC 3.2.1.21) |
|
Gene: BL1757: Beta-glucosidase (EC 3.2.1.21) |
|
|
Beta-glucosidase (EC 3.2.1.21) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |