Regulon of BgrT6 in Bifidobacterium adolescentis ATCC 15703

Properties
Regulator type:	Transcription factor
TF locus tag:	BAD_1207
Regulator family:	TetR
Regulation mode:
Biological process:	Galactosides utilization
Effector:
Regulog:	BgrT6 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - TetR
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -101 Score: 6.8 Sequence: TATCTTATATCTTAAAGATA Position: -94 Score: 7 Sequence: TATCTTAAAGATATAAGATA Locus tag: BAD_1207 Name: bgrT6 Funciton: Predicted beta-galactoside specific transcriptional regulator, TetR family
	BAD_1207	bgrT6	Predicted beta-galactoside specific transcriptional regulator, TetR family
Position: -158 Score: 7 Sequence: TATCTTATATCTTTAAGATA Position: -151 Score: 6.8 Sequence: TATCTTTAAGATATAAGATA Locus tag: BAD_1206 Name: bgaT Funciton: Predicted beta-galactoside permease, MFS family
	BAD_1206	bgaT	Predicted beta-galactoside permease, MFS family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD