Regulog BgrT6 - Bifidobacteriaceae

Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - TetR
- By pathway - Galactosides utilization
Genome | Genes | Operons |
---|---|---|
Bifidobacterium adolescentis ATCC 15703 | 2 | 2 |
Bifidobacterium angulatum DSM 20098 | ||
Bifidobacterium animalis subsp. lactis AD011 | ||
Bifidobacterium bifidum NCIMB 41171 | ||
Bifidobacterium breve DSM 20213 | ||
Bifidobacterium dentium Bd1 | ||
Bifidobacterium gallicum DSM 20093 | ||
Bifidobacterium longum NCC2705 | ||
Bifidobacterium longum subsp. infantis ATCC 15697 | ||
Gardnerella vaginalis 409-05 |
Genes | Function | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | |||||||||||
bgaT |
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -158 score = 6.97915 sequence = TATCTTATATCTTTAAGATA Site: position = -151 score = 6.80597 sequence = TATCTTTAAGATATAAGATA Gene: BAD_1206: Predicted beta-galactoside permease, MFS family |
|
Gene: BLA_0045: Predicted beta-galactoside permease, MFS family |
|
|
|
|
|
|
|
Predicted beta-galactoside permease, MFS family |
CRON 2. | |||||||||||
bgrT6 |
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -101 score = 6.80597 sequence = TATCTTATATCTTAAAGATA Site: position = -94 score = 6.97915 sequence = TATCTTAAAGATATAAGATA Gene: BAD_1207: Predicted beta-galactoside specific transcriptional regulator, TetR family |
|
|
|
|
|
|
|
|
|
Predicted beta-galactoside specific transcriptional regulator, TetR family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |