Regulon of Blon_0374 in Bifidobacterium longum subsp. infantis ATCC 15697

Properties
Regulator type:	Transcription factor
TF locus tag:	Blon_0374
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	Blon_0374 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -106 Score: 6.2 Sequence: TAGTTTATGCGCATCAACAC Position: -52 Score: 6.3 Sequence: TCATTTATGCGCATCAATAT Position: -36 Score: 4.9 Sequence: ATATTGAAGCGTATAACTAA Locus tag: Blon_0375 Name: Blon_0375 Funciton: ABC transporter, sugar-binding component Locus tag: Blon_0376 Name: Blon_0376 Funciton: ABC transporter, permease component Locus tag: Blon_0377 Name: Blon_0377 Funciton: ABC transporter, permease component
	Blon_0375	Blon_0375	ABC transporter, sugar-binding component
	Blon_0376	Blon_0376	ABC transporter, permease component
	Blon_0377	Blon_0377	ABC transporter, permease component

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD