Regulog Blon_0374 - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Carbohydrate metabolism
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | 3 | 1 |
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | ||
| Bifidobacterium dentium Bd1 | ||
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| Blon_0375 |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -36 score = 4.92428 sequence = ATATTGAAGCGTATAACTAA Site: position = -106 score = 6.24679 sequence = TAGTTTATGCGCATCAACAC Site: position = -52 score = 6.25832 sequence = TCATTTATGCGCATCAATAT Gene: Blon_0375: ABC transporter, sugar-binding component |
Gene: BAD_1405: ABC transporter, sugar-binding component |
|
|
|
|
|
|
|
|
ABC transporter, sugar-binding component |
| Blon_0376 |
Gene: Blon_0376: ABC transporter, permease component |
Gene: BAD_1404: ABC transporter, permease component |
|
|
|
|
|
|
|
|
ABC transporter, permease component |
| Blon_0377 |
Gene: Blon_0377: ABC transporter, permease component |
Gene: BAD_1403: ABC transporter, permease component |
|
|
|
|
|
|
|
|
ABC transporter, permease component |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |