Regulon of BgaR in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_0654
Regulator family:	LacI
Regulation mode:
Biological process:	Galactosides utilization
Effector:	Beta-galactosides
Regulog:	BgaR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -124 Score: 6 Sequence: TTTTGTTTGCGTAAACATAT Locus tag: BDP_0659 Name: bgaX Funciton: Putative beta-galactoside ABC transport system, periplasmic component
	BDP_0659	bgaX	Putative beta-galactoside ABC transport system, periplasmic component
Position: -169 Score: 6 Sequence: ATATGTTTACGCAAACAAAA Locus tag: BDP_0658 Name: abfA1 Funciton: Alpha-N-arabinofuranosidase (EC 3.2.1.55)
	BDP_0658	abfA1	Alpha-N-arabinofuranosidase (EC 3.2.1.55)
Position: -270 Score: 5.1 Sequence: TAATGTTTTCGTCATCATAG Position: -179 Score: 5.5 Sequence: TTCTGATAACGTAAACATTT Locus tag: BDP_0655 Name: bgaY Funciton: Putative beta-galactoside ABC transport system, permease component 2 Locus tag: BDP_0656 Name: bgaZ Funciton: Putative beta-galactoside ABC transport system, permease component 1 Locus tag: BDP_0657 Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23)
	BDP_0655	bgaY	Putative beta-galactoside ABC transport system, permease component 2
	BDP_0656	bgaZ	Putative beta-galactoside ABC transport system, permease component 1
	BDP_0657	bgaB	Beta-galactosidase (EC 3.2.1.23)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD