Regulon of BgaR in Bifidobacterium bifidum NCIMB 41171

Properties
Regulator type:	Transcription factor
TF locus tag:	BbifN4_010100008751
Regulator family:	LacI
Regulation mode:
Biological process:	Galactosides utilization
Effector:	Beta-galactosides
Regulog:	BgaR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -128 Score: 5.7 Sequence: AAATGTTTGCGTTACCATGA Locus tag: BbifN4_010100008751 Name: bgaR Funciton: Transcriptional regulator for beta-galactosides utilization, LacI family
	BbifN4_010100008751	bgaR	Transcriptional regulator for beta-galactosides utilization, LacI family
Position: -200 Score: 4.7 Sequence: CTATGTTTTGGTTACCATCA Position: -118 Score: 5.7 Sequence: TCATGGTAACGCAAACATTT Locus tag: BbifN4_010100008756 Name: bgaZ Funciton: Putative beta-galactoside ABC transport system, permease component 1 Locus tag: BbifN4_010100008761 Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23)
	BbifN4_010100008756	bgaZ	Putative beta-galactoside ABC transport system, permease component 1
	BbifN4_010100008761	bgaB	Beta-galactosidase (EC 3.2.1.23)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD