Regulon of BgaR in Bifidobacterium angulatum DSM 20098

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFANG_00301
Regulator family:	LacI
Regulation mode:
Biological process:	Galactosides utilization
Effector:	Beta-galactosides
Regulog:	BgaR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 22 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Beta-galactosides
By pathway - Galactosides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -176 Score: 6 Sequence: AAATGTTTGCGTTATCATTA Locus tag: BIFANG_00301 Name: bgaR Funciton: Transcriptional regulator for beta-galactosides utilization, LacI family
	BIFANG_00301	bgaR	Transcriptional regulator for beta-galactosides utilization, LacI family
Position: -124 Score: 4.8 Sequence: AAATGGTTTCGTCACCATTT Position: -35 Score: 6 Sequence: TAATGATAACGCAAACATTT Locus tag: BIFANG_00302 Name: bgaB Funciton: Beta-galactosidase (EC 3.2.1.23)
	BIFANG_00302	bgaB	Beta-galactosidase (EC 3.2.1.23)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD