Regulon of AouR in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_1707
Regulator family:	LacI
Regulation mode:
Biological process:	Arabinose oligosaccharide utilization
Effector:
Regulog:	AouR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	3
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Arabinose oligosaccharide utilization

Regulated operons
	Locus Tag	Name	Function
Position: -274 Score: 4.6 Sequence: ATATGAAACAGTTTTCGCAT Position: -152 Score: 4.2 Sequence: TGATGAAATGATTTTGAAAA Locus tag: BDP_1706 Name: aouA Funciton: Arabinose oligosaccharide ABC transporter, sugar-binding protein Locus tag: BDP_1705 Name: aouB Funciton: Arabinose oligosaccharide ABC transporter, permease protein 1 Locus tag: BDP_1704 Name: aouC Funciton: Arabinose oligosaccharide ABC transporter, permease component 2 Locus tag: BDP_1703 Name: hypBA1 Funciton: Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185)
	BDP_1706	aouA	Arabinose oligosaccharide ABC transporter, sugar-binding protein
	BDP_1705	aouB	Arabinose oligosaccharide ABC transporter, permease protein 1
	BDP_1704	aouC	Arabinose oligosaccharide ABC transporter, permease component 2
	BDP_1703	hypBA1	Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185)
Position: -296 Score: 4.2 Sequence: TTTTCAAAATCATTTCATCA Position: -174 Score: 4.6 Sequence: ATGCGAAAACTGTTTCATAT Locus tag: BDP_1707 Name: aouR Funciton: Arabinose oligosaccharide utilization transcriptional regulator, LacI family
	BDP_1707	aouR	Arabinose oligosaccharide utilization transcriptional regulator, LacI family
Position: -257 Score: 4.5 Sequence: AGGAGAAATATTTTTCATAT Position: -196 Score: 4.2 Sequence: TTGTGAAAAAATTTCGCATC Locus tag: BDP_1701 Name: hypBA2 Funciton: Beta-L-arabinobiosidase (EC 3.2.1.187)
	BDP_1701	hypBA2	Beta-L-arabinobiosidase (EC 3.2.1.187)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD