Regulog AouR - Bifidobacteriaceae

Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Arabinose oligosaccharide utilization
Genome | Genes | Operons |
---|---|---|
Bifidobacterium longum subsp. infantis ATCC 15697 | ||
Bifidobacterium adolescentis ATCC 15703 | ||
Bifidobacterium angulatum DSM 20098 | ||
Bifidobacterium animalis subsp. lactis AD011 | 3 | 2 |
Bifidobacterium bifidum NCIMB 41171 | ||
Bifidobacterium breve DSM 20213 | ||
Bifidobacterium dentium Bd1 | 6 | 3 |
Bifidobacterium gallicum DSM 20093 | ||
Bifidobacterium longum NCC2705 | 5 | 2 |
Gardnerella vaginalis 409-05 |
Genes | Function | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|
CRON 1. | |||||||||||
aouA |
|
|
|
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -152 score = 4.22024 sequence = TGATGAAATGATTTTGAAAA Site: position = -274 score = 4.62708 sequence = ATATGAAACAGTTTTCGCAT Gene: BDP_1706: Arabinose oligosaccharide ABC transporter, sugar-binding protein |
|
*
Bifidobacterium longum NCC2705 Site: position = -381 score = 4.41337 sequence = ATGCGAAAACTTTCGCAAAC Site: position = -153 score = 3.7964 sequence = TTTTGCAAAAACTTCCATGT Gene: BL0425: Arabinose oligosaccharide ABC transporter, sugar-binding protein |
|
Arabinose oligosaccharide ABC transporter, sugar-binding protein |
aouB |
|
|
|
|
|
|
Gene: BDP_1705: Arabinose oligosaccharide ABC transporter, permease protein 1 |
|
Gene: BL0424: Arabinose oligosaccharide ABC transporter, permease protein 1 |
|
Arabinose oligosaccharide ABC transporter, permease protein 1 |
aouC |
|
|
|
|
|
|
Gene: BDP_1704: Arabinose oligosaccharide ABC transporter, permease component 2 |
|
Gene: BL0423: Arabinose oligosaccharide ABC transporter, permease component 2 |
|
Arabinose oligosaccharide ABC transporter, permease component 2 |
hypBA1 |
|
|
|
*
Bifidobacterium animalis subsp. lactis AD011 Site: position = -113 score = 5.30584 sequence = GGAAGGAAATATTTCCCAAC Gene: BLA_1513: Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185) |
|
Gene: BIFBRE_02037: Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185) |
Gene: BDP_1703: Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185) |
|
Gene: BL0422: Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185) |
|
Non-reducing end beta-L-arabinofuranosidase (EC 3.2.1.185) |
aouT |
|
|
|
Gene: BLA_1512: Arabinose oligosaccharide permease |
|
|
|
|
|
|
Arabinose oligosaccharide permease |
CRON 2. | |||||||||||
aouR |
|
|
|
*
Bifidobacterium animalis subsp. lactis AD011 Site: position = -47 score = 5.30584 sequence = GTTGGGAAATATTTCCTTCC Gene: BLA_1514: Arabinose oligosaccharide utilization transcriptional regulator, LacI family |
|
|
*
Bifidobacterium dentium Bd1 Site: position = -296 score = 4.22024 sequence = TTTTCAAAATCATTTCATCA Site: position = -174 score = 4.62708 sequence = ATGCGAAAACTGTTTCATAT Gene: BDP_1707: Arabinose oligosaccharide utilization transcriptional regulator, LacI family |
|
*
Bifidobacterium longum NCC2705 Site: position = -124 score = 4.41337 sequence = GTTTGCGAAAGTTTTCGCAT Gene: BL0426: Arabinose oligosaccharide utilization transcriptional regulator, LacI family |
|
Arabinose oligosaccharide utilization transcriptional regulator, LacI family |
CRON 3. | |||||||||||
hypBA2 |
|
|
|
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -257 score = 4.45808 sequence = AGGAGAAATATTTTTCATAT Site: position = -196 score = 4.15031 sequence = TTGTGAAAAAATTTCGCATC Gene: BDP_1701: Beta-L-arabinobiosidase (EC 3.2.1.187) |
|
Gene: BL0421: Beta-L-arabinobiosidase (EC 3.2.1.187) |
|
Beta-L-arabinobiosidase (EC 3.2.1.187) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
![]() |
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
![]() |
Regulatory Sites | [ FASTA format ] | DOWNLOAD |