Regulon of TalR in Ralstonia eutropha JMP134

Properties
Regulator type:	Transcription factor
TF locus tag:	Reut_B4642
Regulator family:	LacI
Regulation mode:
Biological process:	L-talarate utilization
Effector:	L-talarate
Regulog:	TalR - Ralstonia
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

By TF family - LacI
By effector - L-talarate
By pathway - L-talarate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -85 Score: 6.3 Sequence: GAATGACAACGTTAGCATTT Position: 35 Score: 6.7 Sequence: AAATGATAACGTTATCATTA Locus tag: Reut_B4643 Name: talD Funciton: L-talarate dehydratase (EC 4.2.1.-) Locus tag: Reut_B4644 Name: tctC Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for L-talarate
	Reut_B4643	talD	L-talarate dehydratase (EC 4.2.1.-)
	Reut_B4644	tctC	Tripartite tricarboxylate transporter family receptor, putative transporter for L-talarate
Position: -201 Score: 6.7 Sequence: TAATGATAACGTTATCATTT Position: -81 Score: 6.3 Sequence: AAATGCTAACGTTGTCATTC Locus tag: Reut_B4642 Name: talR Funciton: Predicted L-talarate-specific transcriptional regulator, LacI family
	Reut_B4642	talR	Predicted L-talarate-specific transcriptional regulator, LacI family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD