Regulog TalR - Ralstonia

Properties
Regulator type:	Transcription factor
Regulator family:	LacI
Regulation mode:
Biological process:	L-talarate utilization
Effector:	L-talarate
Phylum:	Proteobacteria/Beta
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 4 sites [see more]

Member of regulog collections

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes							Function

CRON 1.
talR	Cupriavidus taiwanensis	Ralstonia eutropha H16	* Ralstonia eutropha JMP134 Site: position = -201 score = 6.73733 sequence = TAATGATAACGTTATCATTT Site: position = -81 score = 6.33797 sequence = AAATGCTAACGTTGTCATTC Gene: Reut_B4642: Predicted L-talarate-specific transcriptional regulator, LacI family	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	Predicted L-talarate-specific transcriptional regulator, LacI family

CRON 2.
talD	Cupriavidus taiwanensis	Ralstonia eutropha H16	* Ralstonia eutropha JMP134 Site: position = -85 score = 6.33797 sequence = GAATGACAACGTTAGCATTT Site: position = 35 score = 6.73733 sequence = AAATGATAACGTTATCATTA Gene: Reut_B4643: L-talarate dehydratase (EC 4.2.1.-)	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	L-talarate dehydratase (EC 4.2.1.-)
tctC	Cupriavidus taiwanensis	Ralstonia eutropha H16	Ralstonia eutropha JMP134 Gene: Reut_B4644: Tripartite tricarboxylate transporter family receptor, putative transporter for L-talarate	Ralstonia metallidurans CH34	Ralstonia pickettii 12J	Ralstonia solanacearum GMI1000	Tripartite tricarboxylate transporter family receptor, putative transporter for L-talarate

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --