Regulon of TalR in Delftia acidovorans SPH-1

Properties
Regulator type:	Transcription factor
TF locus tag:	Daci_4288
Regulator family:	LacI
Regulation mode:
Biological process:	L-talarate utilization
Effector:	L-talarate
Regulog:	TalR - Comamonadaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 7 sites [see more]

Member of regulog collections

By TF family - LacI
By effector - L-talarate
By pathway - L-talarate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -212 Score: 6.8 Sequence: GAATGACATCGTTGTCATTT Position: -132 Score: 7 Sequence: AAATGATATCGTTGTCATTT Locus tag: Daci_4288 Name: talR Funciton: Predicted L-talarate-specific transcriptional regulator, LacI family
	Daci_4288	talR	Predicted L-talarate-specific transcriptional regulator, LacI family
Position: -117 Score: 7 Sequence: AAATGACAACGATATCATTT Position: -37 Score: 6.8 Sequence: AAATGACAACGATGTCATTC Locus tag: Daci_4289 Name: tctC Funciton: Tripartite tricarboxylate transporter family receptor, putative transporter for L-talarate Locus tag: Daci_4290 Name: talD Funciton: L-talarate dehydratase (EC 4.2.1.-)
	Daci_4289	tctC	Tripartite tricarboxylate transporter family receptor, putative transporter for L-talarate
	Daci_4290	talD	L-talarate dehydratase (EC 4.2.1.-)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD