Regulon of ScrR in Bifidobacterium dentium Bd1

Properties
Regulator type:	Transcription factor
TF locus tag:	BDP_0102
Regulator family:	LacI
Regulation mode:
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	7
- Operons	4
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -147 Score: 6.3 Sequence: TTATCGAACCGGTTTGACAG Locus tag: BDP_0112 Name: null Funciton: sugar ABC uptake system, solute-binding protein Locus tag: BDP_0113 Name: null Funciton: sugar ABC transport system, permease component Locus tag: BDP_0114 Name: null Funciton: sugar ABC uptake system, permease component
	BDP_0112		sugar ABC uptake system, solute-binding protein
	BDP_0113		sugar ABC transport system, permease component
	BDP_0114		sugar ABC uptake system, permease component
Position: -205 Score: 6.3 Sequence: CTGTCAAACCGGTTCGATAA Locus tag: BDP_0111 Name: null Funciton: oligo-1,6-glucosidase
	BDP_0111		oligo-1,6-glucosidase
Position: -87 Score: 6.8 Sequence: ATATCGAACCGGTTCGATAT Locus tag: BDP_0109 Name: scrP Funciton: Sucrose phosphorylase (EC 2.4.1.7)
	BDP_0109	scrP	Sucrose phosphorylase (EC 2.4.1.7)
Position: -113 Score: 6.8 Sequence: ATATCGAACCGGTTCGACAC Position: -50 Score: 7 Sequence: GTATCGAACCGGTTCGATAC Locus tag: BDP_0115 Name: scrT2 Funciton: Sucrose permease, MFS family Locus tag: BDP_0116 Name: scrT1 Funciton: Sucrose permease, MFS family
	BDP_0115	scrT2	Sucrose permease, MFS family
	BDP_0116	scrT1	Sucrose permease, MFS family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD