Regulon of ScrR in Bifidobacterium animalis subsp. lactis AD011

Properties
Regulator type:	Transcription factor
TF locus tag:	BLA_0128
Regulator family:	LacI
Regulation mode:
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -220 Score: 6.2 Sequence: GTATCGAACCGGTTCGAGTA Position: -153 Score: 6.7 Sequence: GTATCAAACCGGTTCGATAT Position: -61 Score: 6.2 Sequence: TCGTCAAACCGGTTCGATAC Locus tag: BLA_0128 Name: scrR Funciton: Sucrose operon repressor, LacI family
	BLA_0128	scrR	Sucrose operon repressor, LacI family
Position: -265 Score: 6.2 Sequence: GTATCGAACCGGTTTGACGA Position: -173 Score: 6.7 Sequence: ATATCGAACCGGTTTGATAC Position: -106 Score: 6.2 Sequence: TACTCGAACCGGTTCGATAC Locus tag: BLA_0129 Name: scrP Funciton: Sucrose phosphorylase (EC 2.4.1.7) Locus tag: BLA_0130 Name: scrT2 Funciton: Sucrose permease, MFS family
	BLA_0129	scrP	Sucrose phosphorylase (EC 2.4.1.7)
	BLA_0130	scrT2	Sucrose permease, MFS family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD