Regulon of ScrR in Bifidobacterium angulatum DSM 20098

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFANG_00300
Regulator family:	LacI
Regulation mode:
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	ScrR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 23 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -138 Score: 6.8 Sequence: GTGTCGAACCGGTTCGACAC Position: -82 Score: 6.5 Sequence: GAATCGAACCGGTTCGATAG Locus tag: BIFANG_00303 Name: scrP Funciton: Sucrose phosphorylase (EC 2.4.1.7) Locus tag: BIFANG_00304 Name: scrT2 Funciton: Sucrose permease, MFS family Locus tag: BIFANG_00305 Name: scrT1 Funciton: Sucrose permease, MFS family
	BIFANG_00303	scrP	Sucrose phosphorylase (EC 2.4.1.7)
	BIFANG_00304	scrT2	Sucrose permease, MFS family
	BIFANG_00305	scrT1	Sucrose permease, MFS family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD