Regulon of BL0610 in Bifidobacterium longum NCC2705

Properties
Regulator type:	Transcription factor
TF locus tag:	BL0610
Regulator family:	LacI
Regulation mode:
Biological process:	Carbohydrate metabolism
Effector:
Regulog:	BL0610 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Carbohydrate metabolism

Regulated operons
	Locus Tag	Name	Function
Position: -33 Score: 7.1 Sequence: GATTCTTATCGATAAGGTTC Locus tag: BL0610 Name: null Funciton: Transcriptional regulator, LacI family
	BL0610		Transcriptional regulator, LacI family
Position: -48 Score: 7.1 Sequence: GAACCTTATCGATAAGAATC Locus tag: BL0611 Name: null Funciton: hypothetical protein
	BL0611		hypothetical protein

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD