Profile of regulator BL0610 in Bifidobacteriaceae
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Carbohydrate metabolism |
| Effector: | |
| Regulog: | BL0610 - Bifidobacteriaceae |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Carbohydrate metabolism
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Bifidobacterium longum NCC2705 | |||||
| BL0610 | null | -33 | 7.1 | GATTCTTATCGATAAGGTTC | |
| BL0611 | null | -48 | 7.1 | GAACCTTATCGATAAGAATC | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |