Regulon of RbsR3 in Bifidobacterium angulatum DSM 20098

Properties
Regulator type:	Transcription factor
TF locus tag:	BIFANG_00965
Regulator family:	LacI
Regulation mode:
Biological process:	Ribonucleoside utilization
Effector:	Ribose
Regulog:	RbsR3 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 11 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribonucleoside utilization

Regulated operons
	Locus Tag	Name	Function
Position: -92 Score: 6.8 Sequence: ATGATAAAACGTTTTATCAT Locus tag: BIFANG_00967 Name: rihC Funciton: Non-specific ribonucleoside hydrolase (EC 3.2.-.-) Locus tag: BIFANG_00968 Name: iunT Funciton: Predicted pyrimidine nucleoside transporter, MFS family Locus tag: BIFANG_00969 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
	BIFANG_00967	rihC	Non-specific ribonucleoside hydrolase (EC 3.2.-.-)
	BIFANG_00968	iunT	Predicted pyrimidine nucleoside transporter, MFS family
	BIFANG_00969	rbsK	Ribokinase (EC 2.7.1.15)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD