Regulon of BfrR in Bifidobacterium longum subsp. infantis ATCC 15697

Properties
Regulator type:	Transcription factor
TF locus tag:	Blon_2057
Regulator family:	LacI
Regulation mode:
Biological process:	Fructooligosaccharides utilization
Effector:
Regulog:	BfrR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 6 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By pathway - Fructooligosaccharides utilization

Regulated operons
	Locus Tag	Name	Function
Position: -156 Score: 5.9 Sequence: TGAGATAAACGATTAACATT Position: -135 Score: 4.9 Sequence: GACATTAATCGATTAACGTC Locus tag: Blon_2061 Name: bfrB Funciton: Putative fructooligosaccharide ABC transporter, substrate-binding component Locus tag: Blon_2060 Name: bfrC Funciton: Putative fructooligosaccharide ABC transporter, permease component 1 Locus tag: Blon_2059 Name: bfrD Funciton: Putative fructooligosaccharide ABC transporter, permease component 2 Locus tag: Blon_2058 Name: PF04854 Funciton: Predicted integral membrane protein, DUF624 Locus tag: Blon_2057 Name: bfrR Funciton: Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family Locus tag: Blon_2056 Name: bfrA Funciton: Beta-fructosidase (EC 3.2.1.26)
	Blon_2061	bfrB	Putative fructooligosaccharide ABC transporter, substrate-binding component
	Blon_2060	bfrC	Putative fructooligosaccharide ABC transporter, permease component 1
	Blon_2059	bfrD	Putative fructooligosaccharide ABC transporter, permease component 2
	Blon_2058	PF04854	Predicted integral membrane protein, DUF624
	Blon_2057	bfrR	Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family
	Blon_2056	bfrA	Beta-fructosidase (EC 3.2.1.26)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD