Regulog BfrR - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Fructooligosaccharides utilization |
| Effector: | |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By pathway - Fructooligosaccharides utilization
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | 6 | 1 |
| Bifidobacterium adolescentis ATCC 15703 | 6 | 1 |
| Bifidobacterium angulatum DSM 20098 | 6 | 1 |
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | ||
| Bifidobacterium dentium Bd1 | ||
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| bfrB |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -156 score = 5.91169 sequence = TGAGATAAACGATTAACATT Site: position = -135 score = 4.85406 sequence = GACATTAATCGATTAACGTC Gene: Blon_2061: Putative fructooligosaccharide ABC transporter, substrate-binding component |
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -141 score = 6.02227 sequence = TGAGATAAACGATTAACGTT Site: position = -120 score = 4.85406 sequence = GACATTAAACGATTAACGAT Gene: BAD_1330: Putative fructooligosaccharide ABC transporter, substrate-binding component |
*
Bifidobacterium angulatum DSM 20098 Site: position = -140 score = 5.63618 sequence = TGGAATAATCGTTTAACGTT Site: position = -119 score = 4.85406 sequence = GACATTAAACGATTAACGAT Gene: BIFANG_00830: Putative fructooligosaccharide ABC transporter, substrate-binding component |
|
|
|
|
|
|
|
Putative fructooligosaccharide ABC transporter, substrate-binding component |
| bfrC |
Gene: Blon_2060: Putative fructooligosaccharide ABC transporter, permease component 1 |
Gene: BAD_1329: Putative fructooligosaccharide ABC transporter, permease component 1 |
Gene: BIFANG_00831: Putative fructooligosaccharide ABC transporter, permease component 1 |
|
|
|
|
|
|
|
Putative fructooligosaccharide ABC transporter, permease component 1 |
| bfrD |
Gene: Blon_2059: Putative fructooligosaccharide ABC transporter, permease component 2 |
Gene: BAD_1328: Putative fructooligosaccharide ABC transporter, permease component 2 |
Gene: BIFANG_00832: Putative fructooligosaccharide ABC transporter, permease component 2 |
|
|
|
|
|
|
|
Putative fructooligosaccharide ABC transporter, permease component 2 |
| PF04854 |
Gene: Blon_2058: Predicted integral membrane protein, DUF624 |
Gene: BAD_1327: Predicted integral membrane protein, DUF624 |
Gene: BIFANG_00833: Predicted integral membrane protein, DUF624 |
|
|
|
|
|
|
|
Predicted integral membrane protein, DUF624 |
| bfrR |
Gene: Blon_2057: Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family |
Gene: BAD_1326: Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family |
Gene: BIFANG_00834: Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family |
|
|
|
|
|
|
|
Putative transcriptional regulator of fructooligosaccharide utilization, LacI-family |
| bfrA |
Gene: Blon_2056: Beta-fructosidase (EC 3.2.1.26) |
Gene: BAD_1325: Beta-fructosidase (EC 3.2.1.26) |
Gene: BIFANG_00835: Beta-fructosidase (EC 3.2.1.26) |
|
|
|
|
|
|
|
Beta-fructosidase (EC 3.2.1.26) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |