Regulon of SgaR in Bifidobacterium bifidum NCIMB 41171

Properties
Regulator type:	Transcription factor
TF locus tag:	BbifN4_010100001332
Regulator family:	SorC
Regulation mode:
Biological process:	L-xylulose utilization
Effector:	L-xylulose
Regulog:	SgaR - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	5
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - SorC
By effector - L-xylulose
By pathway - L-xylulose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -167 Score: 6.1 Sequence: CGATGAACATGTGTTCATCG Locus tag: BbifN4_010100001337 Name: gatC Funciton: putative L-xylulose permease, PTS system IIC component Locus tag: BbifN4_010100001342 Name: lyxK Funciton: L-xylulose kinase (EC 2.7.1.-) Locus tag: BbifN4_010100001347 Name: sgaU Funciton: L-xylulose 5-phosphate 3-epimerase (EC 5.1.3.-) Locus tag: BbifN4_010100001352 Name: sgaE/araD Funciton: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
	BbifN4_010100001337	gatC	putative L-xylulose permease, PTS system IIC component
	BbifN4_010100001342	lyxK	L-xylulose kinase (EC 2.7.1.-)
	BbifN4_010100001347	sgaU	L-xylulose 5-phosphate 3-epimerase (EC 5.1.3.-)
	BbifN4_010100001352	sgaE/araD	L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4)
Position: -201 Score: 6.1 Sequence: CGATGAACACATGTTCATCG Locus tag: BbifN4_010100001332 Name: sgaR Funciton: Putative transcriptional regulator of L-ascorbate utilization, SorC family
	BbifN4_010100001332	sgaR	Putative transcriptional regulator of L-ascorbate utilization, SorC family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD