Profile of regulator SgaR in Bifidobacteriaceae
| Regulator family: | SorC |
| Regulation mode: | |
| Biological process: | L-xylulose utilization |
| Effector: | L-xylulose |
| Regulog: | SgaR - Bifidobacteriaceae |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - SorC
- By effector - L-xylulose
- By pathway - L-xylulose utilization
Transcription factor binding sites
| Locus Tag | Name | Position | Score | Sequence | |
|---|---|---|---|---|---|
| Bifidobacterium bifidum NCIMB 41171 | |||||
| BbifN4_010100001337 | gatC | -167 | 6.1 | CGATGAACATGTGTTCATCG | |
| BbifN4_010100001332 | sgaR | -201 | 6.1 | CGATGAACACATGTTCATCG | |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |