Regulog SgaR - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | SorC |
| Regulation mode: | |
| Biological process: | L-xylulose utilization |
| Effector: | L-xylulose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - SorC
- By effector - L-xylulose
- By pathway - L-xylulose utilization
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | 5 | 2 |
| Bifidobacterium breve DSM 20213 | ||
| Bifidobacterium dentium Bd1 | ||
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| sgaR |
|
|
|
|
*
Bifidobacterium bifidum NCIMB 41171 Site: position = -201 score = 6.06093 sequence = CGATGAACACATGTTCATCG Gene: BbifN4_010100001332: Putative transcriptional regulator of L-ascorbate utilization, SorC family |
|
|
|
|
|
Putative transcriptional regulator of L-ascorbate utilization, SorC family |
| CRON 2. | |||||||||||
| gatC |
|
|
|
|
*
Bifidobacterium bifidum NCIMB 41171 Site: position = -167 score = 6.06093 sequence = CGATGAACATGTGTTCATCG Gene: BbifN4_010100001337: putative L-xylulose permease, PTS system IIC component |
|
|
|
|
|
putative L-xylulose permease, PTS system IIC component |
| lyxK |
|
|
|
|
Gene: BbifN4_010100001342: L-xylulose kinase (EC 2.7.1.-) |
|
|
|
|
|
L-xylulose kinase (EC 2.7.1.-) |
| sgaU |
|
|
|
|
Gene: BbifN4_010100001347: L-xylulose 5-phosphate 3-epimerase (EC 5.1.3.-) |
|
|
|
|
|
L-xylulose 5-phosphate 3-epimerase (EC 5.1.3.-) |
| sgaE/araD |
|
|
|
|
Gene: BbifN4_010100001352: L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
|
|
|
|
|
L-ribulose-5-phosphate 4-epimerase (EC 5.1.3.4) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |