Regulon of RbsR1 in Gardnerella vaginalis 409-05

Properties
Regulator type:	Transcription factor
TF locus tag:	HMPREF0424_1339
Regulator family:	LacI
Regulation mode:
Biological process:	Ribose utilization
Effector:	Ribose
Regulog:	RbsR1 - Bifidobacteriaceae
Statistics of regulated genes:
- Genes	6
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 5 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Ribose
By pathway - Ribose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -281 Score: 7.1 Sequence: TTGCGGTAACGTTACCGCAT Position: -237 Score: 5.1 Sequence: TTGTGGGAACGTTATCTCAA Locus tag: HMPREF0424_1339 Name: rbsR1 Funciton: Transcriptional repressor of ribose utilization, LacI family Locus tag: HMPREF0424_1338 Name: rbsA Funciton: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) Locus tag: HMPREF0424_1337 Name: rbsC Funciton: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) Locus tag: HMPREF0424_1336 Name: rbsB Funciton: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) Locus tag: HMPREF0424_1335 Name: rbsD Funciton: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) Locus tag: HMPREF0424_1334 Name: rbsK Funciton: Ribokinase (EC 2.7.1.15)
	HMPREF0424_1339	rbsR1	Transcriptional repressor of ribose utilization, LacI family
	HMPREF0424_1338	rbsA	Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1)
	HMPREF0424_1337	rbsC	Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1)
	HMPREF0424_1336	rbsB	Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1)
	HMPREF0424_1335	rbsD	D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1)
	HMPREF0424_1334	rbsK	Ribokinase (EC 2.7.1.15)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD