Regulog RbsR1 - Bifidobacteriaceae
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Ribose utilization |
| Effector: | Ribose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By effector - Ribose
- By pathway - Ribose utilization
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | ||
| Bifidobacterium adolescentis ATCC 15703 | ||
| Bifidobacterium angulatum DSM 20098 | ||
| Bifidobacterium animalis subsp. lactis AD011 | ||
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | ||
| Bifidobacterium dentium Bd1 | 5 | 2 |
| Bifidobacterium gallicum DSM 20093 | ||
| Bifidobacterium longum NCC2705 | ||
| Gardnerella vaginalis 409-05 | 6 | 1 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| rbsR1 |
|
|
|
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -232 score = 6.61805 sequence = TTGTGGTAACGTTACCGCAT Site: position = -187 score = 7.03896 sequence = ATGAGGTAACGTTACCGCAT Gene: BDP_0171: Transcriptional repressor of ribose utilization, LacI family |
|
|
*
Gardnerella vaginalis 409-05 Site: position = -237 score = 5.13559 sequence = TTGTGGGAACGTTATCTCAA Site: position = -281 score = 7.12754 sequence = TTGCGGTAACGTTACCGCAT Gene: HMPREF0424_1339: Transcriptional repressor of ribose utilization, LacI family |
Transcriptional repressor of ribose utilization, LacI family |
| rbsA |
|
|
|
|
|
|
*
Bifidobacterium dentium Bd1 Site: position = -41 score = 6.90508 sequence = GTGCGGTAACGTTGCCGCAC Gene: BDP_0172: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
|
|
Gene: HMPREF0424_1338: Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
Ribose ABC transport system, ATP-binding protein RbsA (TC 3.A.1.2.1) |
| rbsC |
|
|
|
|
|
|
Gene: BDP_0173: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
|
|
Gene: HMPREF0424_1337: Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
Ribose ABC transport system, permease protein RbsC (TC 3.A.1.2.1) |
| rbsB |
|
|
|
|
|
|
Gene: BDP_0174: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
|
|
Gene: HMPREF0424_1336: Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
Ribose ABC transport system, periplasmic ribose-binding protein RbsB (TC 3.A.1.2.1) |
| rbsD |
|
|
|
|
|
|
Gene: BDP_0175: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
|
|
Gene: HMPREF0424_1335: D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
D-ribose pyranase (D-ribose mutarotase) (EC 5.5.1.n1) |
| rbsK |
|
|
|
|
|
|
Gene: BDP_2024: Ribokinase (EC 2.7.1.15) |
|
|
Gene: HMPREF0424_1334: Ribokinase (EC 2.7.1.15) |
Ribokinase (EC 2.7.1.15) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |