Regulon of CscR in Bifidobacterium adolescentis ATCC 15703

Properties
Regulator type:	Transcription factor
TF locus tag:	BAD_1148
Regulator family:	LacI
Regulation mode:
Biological process:	Sucrose utilization
Effector:	Sucrose
Regulog:	CscR - Bifidobacteria
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 16 sites [see more]

Member of regulog collections

By taxonomy - Bifidobacteriaceae
By TF family - LacI
By effector - Sucrose
By pathway - Sucrose utilization

Regulated operons
	Locus Tag	Name	Function
Position: -84 Score: 7 Sequence: GACGTCAAACGATTGACGTC Position: -70 Score: 6.4 Sequence: GACGTCAAACGATTGACGAA Locus tag: BAD_1149 Name: cscB Funciton: Sucrose permease, major facilitator superfamily Locus tag: BAD_1150 Name: cscA Funciton: Sucrase (EC 3.2.1.26)
	BAD_1149	cscB	Sucrose permease, major facilitator superfamily
	BAD_1150	cscA	Sucrase (EC 3.2.1.26)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD