Regulog CscR - Bifidobacteria
| Regulator type: | Transcription factor |
| Regulator family: | LacI |
| Regulation mode: | |
| Biological process: | Sucrose utilization |
| Effector: | Sucrose |
| Phylum: | Actinobacteria |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Bifidobacteriaceae
- By TF family - LacI
- By effector - Sucrose
- By pathway - Sucrose utilization
| Genome | Genes | Operons |
|---|---|---|
| Bifidobacterium longum subsp. infantis ATCC 15697 | 2 | 1 |
| Bifidobacterium adolescentis ATCC 15703 | 2 | 1 |
| Bifidobacterium angulatum DSM 20098 | 2 | 1 |
| Bifidobacterium animalis subsp. lactis AD011 | 2 | 1 |
| Bifidobacterium bifidum NCIMB 41171 | ||
| Bifidobacterium breve DSM 20213 | 2 | 1 |
| Bifidobacterium dentium Bd1 | 2 | 1 |
| Bifidobacterium gallicum DSM 20093 | 2 | 1 |
| Bifidobacterium longum NCC2705 | 2 | 1 |
| Gardnerella vaginalis 409-05 |
| Genes | Function | ||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||
| cscB |
*
Bifidobacterium longum subsp. infantis ATCC 15697 Site: position = -134 score = 7.13008 sequence = GACGTCAATCGATTGACGTA Site: position = -120 score = 6.8378 sequence = GACGTAAATCGATTGACGTC Gene: Blon_0788: Sucrose permease, major facilitator superfamily |
*
Bifidobacterium adolescentis ATCC 15703 Site: position = -70 score = 6.39319 sequence = GACGTCAAACGATTGACGAA Site: position = -84 score = 7.00405 sequence = GACGTCAAACGATTGACGTC Gene: BAD_1149: Sucrose permease, major facilitator superfamily |
*
Bifidobacterium angulatum DSM 20098 Site: position = -12 score = 6.01236 sequence = GACGTAAATCGATTGACGCT Site: position = -26 score = 7.0572 sequence = TACGTCAATCGATTGACGTA Gene: BIFANG_01828: Sucrose permease, major facilitator superfamily |
*
Bifidobacterium animalis subsp. lactis AD011 Site: position = -217 score = 6.27373 sequence = GAAGTCAATCGTTTGATGTC Gene: BLA_0818: Sucrose permease, major facilitator superfamily |
|
*
Bifidobacterium breve DSM 20213 Site: position = -114 score = 6.8378 sequence = GACGTAAATCGATTGACGTC Site: position = -128 score = 7.13008 sequence = GACGTCAATCGATTGACGTA Gene: BIFBRE_00577: Sucrose permease, major facilitator superfamily |
*
Bifidobacterium dentium Bd1 Site: position = -158 score = 6.47264 sequence = GGCGTCAATCGATTTACGTC Site: position = -144 score = 6.84262 sequence = TACGTCAATCGATTGACGTG Gene: BDP_1602: Sucrose permease, major facilitator superfamily |
*
Bifidobacterium gallicum DSM 20093 Site: position = -167 score = 6.10573 sequence = AACGTCAATCGTTTGACGCA Site: position = -121 score = 6.56601 sequence = TGCGTCAATCGTTTGACGTC Site: position = -107 score = 6.15252 sequence = GACGTCAAACGTTTGACGCG Gene: BIFGAL_00341: Sucrose permease, major facilitator superfamily |
*
Bifidobacterium longum NCC2705 Site: position = -134 score = 7.0572 sequence = TACGTCAATCGATTGACGTA Site: position = -120 score = 6.8378 sequence = GACGTAAATCGATTGACGTC Gene: BL0106: Sucrose permease, major facilitator superfamily |
|
Sucrose permease, major facilitator superfamily |
| cscA |
Gene: Blon_0787: Sucrase (EC 3.2.1.26) |
Gene: BAD_1150: Sucrase (EC 3.2.1.26) |
Gene: BIFANG_01829: Sucrase (EC 3.2.1.26) |
Gene: BLA_0819: Sucrase (EC 3.2.1.26) |
|
Gene: BIFBRE_00576: Sucrase (EC 3.2.1.26) |
Gene: BDP_1603: Sucrase (EC 3.2.1.26) |
Gene: BIFGAL_00342: Sucrase (EC 3.2.1.26) |
Gene: BL0105: Sucrase (EC 3.2.1.26) |
|
Sucrase (EC 3.2.1.26) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |