Regulon of SdaR in Xanthomonas axonopodis pv. citri str. 306

Properties
Regulator type:	Transcription factor
TF locus tag:	XAC4359
Regulator family:	SdaR
Regulation mode:	activator
Biological process:	Glycerate utilization
Effector:	D-glycerate
Regulog:	SdaR - Xanthomonadales
Statistics of regulated genes:
- Genes	3
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

By taxonomy - Xanthomonadales
By trascription factor - SdaR
By TF family - SdaR
By effector - D-glycerate
By pathway - Glycerate utilization

Regulated operons
	Locus Tag	Name	Function
Position: -102 Score: 6.1 Sequence: ATTTGGGCAGTTGCACAAAA Locus tag: XAC4361 Name: grtP Funciton: D-glycerate transporter, GntP family Locus tag: XAC4360 Name: garK Funciton: Glycerate kinase (EC 2.7.1.31) Locus tag: XAC4359 Name: sdaR Funciton: Glycerate utilization transcriptional regulator SdaR, SdaR family
	XAC4361	grtP	D-glycerate transporter, GntP family
	XAC4360	garK	Glycerate kinase (EC 2.7.1.31)
	XAC4359	sdaR	Glycerate utilization transcriptional regulator SdaR, SdaR family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD