Regulog SdaR - Xanthomonadales

Properties
Regulator type:	Transcription factor
Regulator family:	SdaR
Regulation mode:	activator
Biological process:	Glycerate utilization
Effector:	D-glycerate
Phylum:	Proteobacteria/Gamma
Visualization:
	Allows to visualize regulog content in the context of metabolic pathways

Built upon 2 sites [see more]

Member of regulog collections

Statistics of regulated genes
Genome	Genes	Operons
Stenotrophomonas maltophilia K279a
Xanthomonas axonopodis pv. citri str. 306	3	1
Xanthomonas campestris pv. campestris str. ATCC 33913	3	1
Xylella fastidiosa 9a5c

Clusters of co-Regulated Orthologous operoNs (CRONs)
Genes					Function

CRON 1.
grtP	Stenotrophomonas maltophilia K279a	* Xanthomonas axonopodis pv. citri str. 306 Site: position = -102 score = 6.08382 sequence = ATTTGGGCAGTTGCACAAAA Gene: XAC4361: D-glycerate transporter, GntP family	* Xanthomonas campestris pv. campestris str. ATCC 33913 Site: position = -88 score = 5.12387 sequence = GCTTGGGTGTTTGCACAAAA Gene: XCC4227: D-glycerate transporter, GntP family	Xylella fastidiosa 9a5c	D-glycerate transporter, GntP family
garK	Stenotrophomonas maltophilia K279a	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC4360: Glycerate kinase (EC 2.7.1.31)	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC4226: Glycerate kinase (EC 2.7.1.31)	Xylella fastidiosa 9a5c	Glycerate kinase (EC 2.7.1.31)
sdaR	Stenotrophomonas maltophilia K279a	Xanthomonas axonopodis pv. citri str. 306 Gene: XAC4359: Glycerate utilization transcriptional regulator SdaR, SdaR family	Xanthomonas campestris pv. campestris str. ATCC 33913 Gene: XCC4225: Glycerate utilization transcriptional regulator SdaR, SdaR family	Xylella fastidiosa 9a5c	Glycerate utilization transcriptional regulator SdaR, SdaR family

Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.

Red color - the gene is in non-regulated operon.

Gray color - the orthologous gene is absent.

The star symbol - the TFBS is located in upstream region of this gene.

The number - the numeber of homologs (shown only if it is greater than one).

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD

Collection of Manually Curated Inferences of Regulons in Prokaryotic Genomes -- version 3.2 --