Regulon of SO4705 in Shewanella denitrificans OS217

Properties
Regulator type:	Transcription factor
TF locus tag:	Sden_0218
Regulator family:	XRE
Regulation mode:	repressor
Biological process:
Effector:
Regulog:	SO4705 - Shewanellaceae
Statistics of regulated genes:
- Genes	2
- Operons	2
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 32 sites [see more]

Member of regulog collections

By taxonomy - Shewanellaceae
By TF family - XRE

Regulated operons
	Locus Tag	Name	Function
Position: -128 Score: 7 Sequence: TTGTAGCGAAAATTGTTTTAGACTACAA Locus tag: Sden_0217 Name: SO4706 Funciton: Malate synthase-related protein
	Sden_0217	SO4706	Malate synthase-related protein
Position: -65 Score: 7 Sequence: TTGTAGTCTAAAACAATTTTCGCTACAA Locus tag: Sden_0218 Name: SO4705 Funciton: transcriptional regulator, XRE family
	Sden_0218	SO4705	transcriptional regulator, XRE family

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD