Statistics of regulated genes

Genome	Genes	Operons
Shewanella oneidensis MR-1	2	2
Shewanella putrefaciens CN-32	2	2
Shewanella sp W3-18-1	2	2
Shewanella sp ANA-3	2	2
Shewanella sp MR-4	2	2
Shewanella sp MR-7	2	2
Shewanella baltica OS155	2	2
Shewanella denitrificans OS217	2	2
Shewanella frigidimarina NCIMB 400	2	2
Shewanella amazonensis SB2B	2	2
Shewanella loihica PV-4	2	2
Shewanella pealeana ATCC 700345	2	2
Shewanella halifaxensis HAW-EB4	2	2
Shewanella piezotolerans WP3	2	2
Shewanella sediminis HAW-EB3	2	2
Shewanella woodyi ATCC 51908	2	2

Clusters of co-Regulated Orthologous operoNs (CRONs)

Genes																	Function
CRON 1.
SO4706	* Shewanella oneidensis MR-1 Site: position = -174 score = 7.39987 sequence = TTGTAGTAAAAAATACACTAGACTACAA Gene: SO_4706: Malate synthase-related protein	* Shewanella putrefaciens CN-32 Site: position = -216 score = 7.31123 sequence = TTGTAGTCAAAAAAAGACTAGACTACAA Gene: Sputcn32_3867: Malate synthase-related protein	* Shewanella sp W3-18-1 Site: position = -216 score = 7.31123 sequence = TTGTAGTCAAAAAAAGACTAGACTACAA Gene: Sputw3181_0086: Malate synthase-related protein	* Shewanella sp ANA-3 Site: position = -171 score = 7.31123 sequence = TTGTAGTCAAAAAAAGACTAGACTACAA Gene: Shewana3_4060: Malate synthase-related protein	* Shewanella sp MR-4 Site: position = -172 score = 7.04315 sequence = TTGTAGCCAAAAAAAGACTAGACTACAA Gene: Shewmr4_3852: Malate synthase-related protein	* Shewanella sp MR-7 Site: position = -171 score = 7.31123 sequence = TTGTAGTCAAAAAAAGACTAGACTACAA Gene: Shewmr7_3945: Malate synthase-related protein	* Shewanella baltica OS155 Site: position = -214 score = 7.31123 sequence = TTGTAGTCAAAAAAAGACTAGACTACAA Gene: Sbal_0105: Malate synthase-related protein	* Shewanella denitrificans OS217 Site: position = -128 score = 6.97245 sequence = TTGTAGCGAAAATTGTTTTAGACTACAA Gene: Sden_0217: Malate synthase-related protein	* Shewanella frigidimarina NCIMB 400 Site: position = -111 score = 4.78716 sequence = TTGTttgtAAAAATAgcaTAGACTAaAA Gene: Sfri_3904: Malate synthase-related protein	* Shewanella amazonensis SB2B Site: position = -119 score = 6.62375 sequence = TTGTAGTAAAAAATAACATAGACTAAAA Gene: Sama_0681: Malate synthase-related protein	* Shewanella loihica PV-4 Site: position = -144 score = 6.60647 sequence = TTGTAATGAAAAAGCCGCTAGACTACAA Gene: Shew_2559: Malate synthase-related protein	* Shewanella pealeana ATCC 700345 Site: position = -112 score = 7.0157 sequence = TTGTAATGAAAATTACACTAGACTACAA Gene: Spea_2005: Malate synthase-related protein	* Shewanella halifaxensis HAW-EB4 Site: position = -113 score = 6.9014 sequence = TTGTAATAAAATTTACACTAGACTACAA Gene: Shal_2296: Malate synthase-related protein	* Shewanella piezotolerans WP3 Site: position = -120 score = 5.6935 sequence = TTGTAGCGGTTTTTACACTAGACTACAA Gene: swp_2677: Malate synthase-related protein	* Shewanella sediminis HAW-EB3 Site: position = -170 score = 7.14345 sequence = TTGTAGTAAAAAATTCGCTAGACTACAA Gene: Ssed_1609: Malate synthase-related protein	* Shewanella woodyi ATCC 51908 Site: position = -137 score = 6.83728 sequence = TTGTAATGAAAAATTAGCTAGACTACAA Gene: Swoo_3043: Malate synthase-related protein	Malate synthase-related protein
CRON 2.
SO4705	* Shewanella oneidensis MR-1 Site: position = -86 score = 7.39987 sequence = TTGTAGTCTAGTGTATTTTTTACTACAA Gene: SO_4705: transcriptional regulator, XRE family	* Shewanella putrefaciens CN-32 Site: position = -65 score = 7.31123 sequence = TTGTAGTCTAGTCTTTTTTTGACTACAA Gene: Sputcn32_3866: transcriptional regulator, XRE family	* Shewanella sp W3-18-1 Site: position = -65 score = 7.31123 sequence = TTGTAGTCTAGTCTTTTTTTGACTACAA Gene: Sputw3181_0087: transcriptional regulator, XRE family	* Shewanella sp ANA-3 Site: position = -65 score = 7.31123 sequence = TTGTAGTCTAGTCTTTTTTTGACTACAA Gene: Shewana3_4059: transcriptional regulator, XRE family	* Shewanella sp MR-4 Site: position = -65 score = 7.04315 sequence = TTGTAGTCTAGTCTTTTTTTGGCTACAA Gene: Shewmr4_3851: transcriptional regulator, XRE family	* Shewanella sp MR-7 Site: position = -65 score = 7.31123 sequence = TTGTAGTCTAGTCTTTTTTTGACTACAA Gene: Shewmr7_3944: transcriptional regulator, XRE family	* Shewanella baltica OS155 Site: position = -65 score = 7.31123 sequence = TTGTAGTCTAGTCTTTTTTTGACTACAA Gene: Sbal_0106: transcriptional regulator, XRE family	* Shewanella denitrificans OS217 Site: position = -65 score = 6.97245 sequence = TTGTAGTCTAAAACAATTTTCGCTACAA Gene: Sden_0218: transcriptional regulator, XRE family	* Shewanella frigidimarina NCIMB 400 Site: position = -64 score = 4.78716 sequence = TTtTAGTCTAtgcTATTTTTacaaACAA Gene: Sfri_3903: transcriptional regulator, XRE family	* Shewanella amazonensis SB2B Site: position = -65 score = 6.62375 sequence = TTTTAGTCTATGTTATTTTTTACTACAA Gene: Sama_0680: transcriptional regulator, XRE family	* Shewanella loihica PV-4 Site: position = -65 score = 6.60647 sequence = TTGTAGTCTAGCGGCTTTTTCATTACAA Gene: Shew_2560: transcriptional regulator, XRE family	* Shewanella pealeana ATCC 700345 Site: position = -65 score = 7.0157 sequence = TTGTAGTCTAGTGTAATTTTCATTACAA Gene: Spea_2004: transcriptional regulator, XRE family	* Shewanella halifaxensis HAW-EB4 Site: position = -65 score = 6.9014 sequence = TTGTAGTCTAGTGTAAATTTTATTACAA Gene: Shal_2297: transcriptional regulator, XRE family	* Shewanella piezotolerans WP3 Site: position = -65 score = 5.6935 sequence = TTGTAGTCTAGTGTAAAAACCGCTACAA Gene: swp_2678: transcriptional regulator, XRE family	* Shewanella sediminis HAW-EB3 Site: position = -65 score = 7.14345 sequence = TTGTAGTCTAGCGAATTTTTTACTACAA Gene: Ssed_1608: transcriptional regulator, XRE family	* Shewanella woodyi ATCC 51908 Site: position = -84 score = 6.83728 sequence = TTGTAGTCTAGCTAATTTTTCATTACAA Gene: Swoo_3044: transcriptional regulator, XRE family	transcriptional regulator, XRE family

Export

	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD