Regulog SO4705 - Shewanellaceae
| Regulator type: | Transcription factor |
| Regulator family: | XRE |
| Regulation mode: | repressor |
| Biological process: | |
| Effector: | |
| Phylum: | Proteobacteria/gamma |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Shewanellaceae
- By TF family - XRE
| Genome | Genes | Operons |
|---|---|---|
| Shewanella oneidensis MR-1 | 2 | 2 |
| Shewanella putrefaciens CN-32 | 2 | 2 |
| Shewanella sp W3-18-1 | 2 | 2 |
| Shewanella sp ANA-3 | 2 | 2 |
| Shewanella sp MR-4 | 2 | 2 |
| Shewanella sp MR-7 | 2 | 2 |
| Shewanella baltica OS155 | 2 | 2 |
| Shewanella denitrificans OS217 | 2 | 2 |
| Shewanella frigidimarina NCIMB 400 | 2 | 2 |
| Shewanella amazonensis SB2B | 2 | 2 |
| Shewanella loihica PV-4 | 2 | 2 |
| Shewanella pealeana ATCC 700345 | 2 | 2 |
| Shewanella halifaxensis HAW-EB4 | 2 | 2 |
| Shewanella piezotolerans WP3 | 2 | 2 |
| Shewanella sediminis HAW-EB3 | 2 | 2 |
| Shewanella woodyi ATCC 51908 | 2 | 2 |
| Genes | Function | ||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||||||||||
| SO4706 |
*
Shewanella oneidensis MR-1 Site: position = -174 score = 7.39987 sequence = TTGTAGTAAAAAATACACTAGACTACAA Gene: SO_4706: Malate synthase-related protein |
*
Shewanella putrefaciens CN-32 Site: position = -216 score = 7.31123 sequence = TTGTAGTCAAAAAAAGACTAGACTACAA Gene: Sputcn32_3867: Malate synthase-related protein |
*
Shewanella sp W3-18-1 Site: position = -216 score = 7.31123 sequence = TTGTAGTCAAAAAAAGACTAGACTACAA Gene: Sputw3181_0086: Malate synthase-related protein |
*
Shewanella sp ANA-3 Site: position = -171 score = 7.31123 sequence = TTGTAGTCAAAAAAAGACTAGACTACAA Gene: Shewana3_4060: Malate synthase-related protein |
*
Shewanella sp MR-4 Site: position = -172 score = 7.04315 sequence = TTGTAGCCAAAAAAAGACTAGACTACAA Gene: Shewmr4_3852: Malate synthase-related protein |
*
Shewanella sp MR-7 Site: position = -171 score = 7.31123 sequence = TTGTAGTCAAAAAAAGACTAGACTACAA Gene: Shewmr7_3945: Malate synthase-related protein |
*
Shewanella baltica OS155 Site: position = -214 score = 7.31123 sequence = TTGTAGTCAAAAAAAGACTAGACTACAA Gene: Sbal_0105: Malate synthase-related protein |
*
Shewanella denitrificans OS217 Site: position = -128 score = 6.97245 sequence = TTGTAGCGAAAATTGTTTTAGACTACAA Gene: Sden_0217: Malate synthase-related protein |
*
Shewanella frigidimarina NCIMB 400 Site: position = -111 score = 4.78716 sequence = TTGTttgtAAAAATAgcaTAGACTAaAA Gene: Sfri_3904: Malate synthase-related protein |
*
Shewanella amazonensis SB2B Site: position = -119 score = 6.62375 sequence = TTGTAGTAAAAAATAACATAGACTAAAA Gene: Sama_0681: Malate synthase-related protein |
*
Shewanella loihica PV-4 Site: position = -144 score = 6.60647 sequence = TTGTAATGAAAAAGCCGCTAGACTACAA Gene: Shew_2559: Malate synthase-related protein |
*
Shewanella pealeana ATCC 700345 Site: position = -112 score = 7.0157 sequence = TTGTAATGAAAATTACACTAGACTACAA Gene: Spea_2005: Malate synthase-related protein |
*
Shewanella halifaxensis HAW-EB4 Site: position = -113 score = 6.9014 sequence = TTGTAATAAAATTTACACTAGACTACAA Gene: Shal_2296: Malate synthase-related protein |
*
Shewanella piezotolerans WP3 Site: position = -120 score = 5.6935 sequence = TTGTAGCGGTTTTTACACTAGACTACAA Gene: swp_2677: Malate synthase-related protein |
*
Shewanella sediminis HAW-EB3 Site: position = -170 score = 7.14345 sequence = TTGTAGTAAAAAATTCGCTAGACTACAA Gene: Ssed_1609: Malate synthase-related protein |
*
Shewanella woodyi ATCC 51908 Site: position = -137 score = 6.83728 sequence = TTGTAATGAAAAATTAGCTAGACTACAA Gene: Swoo_3043: Malate synthase-related protein |
Malate synthase-related protein |
| CRON 2. | |||||||||||||||||
| SO4705 |
*
Shewanella oneidensis MR-1 Site: position = -86 score = 7.39987 sequence = TTGTAGTCTAGTGTATTTTTTACTACAA Gene: SO_4705: transcriptional regulator, XRE family |
*
Shewanella putrefaciens CN-32 Site: position = -65 score = 7.31123 sequence = TTGTAGTCTAGTCTTTTTTTGACTACAA Gene: Sputcn32_3866: transcriptional regulator, XRE family |
*
Shewanella sp W3-18-1 Site: position = -65 score = 7.31123 sequence = TTGTAGTCTAGTCTTTTTTTGACTACAA Gene: Sputw3181_0087: transcriptional regulator, XRE family |
*
Shewanella sp ANA-3 Site: position = -65 score = 7.31123 sequence = TTGTAGTCTAGTCTTTTTTTGACTACAA Gene: Shewana3_4059: transcriptional regulator, XRE family |
*
Shewanella sp MR-4 Site: position = -65 score = 7.04315 sequence = TTGTAGTCTAGTCTTTTTTTGGCTACAA Gene: Shewmr4_3851: transcriptional regulator, XRE family |
*
Shewanella sp MR-7 Site: position = -65 score = 7.31123 sequence = TTGTAGTCTAGTCTTTTTTTGACTACAA Gene: Shewmr7_3944: transcriptional regulator, XRE family |
*
Shewanella baltica OS155 Site: position = -65 score = 7.31123 sequence = TTGTAGTCTAGTCTTTTTTTGACTACAA Gene: Sbal_0106: transcriptional regulator, XRE family |
*
Shewanella denitrificans OS217 Site: position = -65 score = 6.97245 sequence = TTGTAGTCTAAAACAATTTTCGCTACAA Gene: Sden_0218: transcriptional regulator, XRE family |
*
Shewanella frigidimarina NCIMB 400 Site: position = -64 score = 4.78716 sequence = TTtTAGTCTAtgcTATTTTTacaaACAA Gene: Sfri_3903: transcriptional regulator, XRE family |
*
Shewanella amazonensis SB2B Site: position = -65 score = 6.62375 sequence = TTTTAGTCTATGTTATTTTTTACTACAA Gene: Sama_0680: transcriptional regulator, XRE family |
*
Shewanella loihica PV-4 Site: position = -65 score = 6.60647 sequence = TTGTAGTCTAGCGGCTTTTTCATTACAA Gene: Shew_2560: transcriptional regulator, XRE family |
*
Shewanella pealeana ATCC 700345 Site: position = -65 score = 7.0157 sequence = TTGTAGTCTAGTGTAATTTTCATTACAA Gene: Spea_2004: transcriptional regulator, XRE family |
*
Shewanella halifaxensis HAW-EB4 Site: position = -65 score = 6.9014 sequence = TTGTAGTCTAGTGTAAATTTTATTACAA Gene: Shal_2297: transcriptional regulator, XRE family |
*
Shewanella piezotolerans WP3 Site: position = -65 score = 5.6935 sequence = TTGTAGTCTAGTGTAAAAACCGCTACAA Gene: swp_2678: transcriptional regulator, XRE family |
*
Shewanella sediminis HAW-EB3 Site: position = -65 score = 7.14345 sequence = TTGTAGTCTAGCGAATTTTTTACTACAA Gene: Ssed_1608: transcriptional regulator, XRE family |
*
Shewanella woodyi ATCC 51908 Site: position = -84 score = 6.83728 sequence = TTGTAGTCTAGCTAATTTTTCATTACAA Gene: Swoo_3044: transcriptional regulator, XRE family |
transcriptional regulator, XRE family |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |