Regulon of NagR in Clostridium perfringens ATCC 13124

Properties
Regulator type:	Transcription factor
TF locus tag:	CPF_2745
Regulator family:	GntR/Others
Regulation mode:
Biological process:	N-acetylglucosamine utilization
Effector:
Regulog:	NagR - Clostridia-1
Statistics of regulated genes:
- Genes	2
- Operons	1
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 3 sites [see more]

Member of regulog collections

By taxonomy - Clostridia-1
By TF family - GntR/Others
By pathway - N-acetylglucosamine utilization

Regulated operons
	Locus Tag	Name	Function
Position: -57 Score: 5.5 Sequence: ATAGTGGTCTAGACAAGTTA Locus tag: CPF_2745 Name: nagR Funciton: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family Locus tag: CPF_2744 Name: nagB Funciton: Glucosamine-6-phosphate deaminase (EC 3.5.99.6)
	CPF_2745	nagR	Transcriptional regulator of N-Acetylglucosamine utilization, GntR family
	CPF_2744	nagB	Glucosamine-6-phosphate deaminase (EC 3.5.99.6)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD