Regulog NagR - Clostridia-1
| Regulator type: | Transcription factor |
| Regulator family: | GntR/Others |
| Regulation mode: | |
| Biological process: | N-acetylglucosamine utilization |
| Effector: | |
| Phylum: | Firmicutes |
| Visualization: | |
|
Allows to visualize regulog content in the context of metabolic pathways |
Member of regulog collections
- By taxonomy - Clostridia-1
- By TF family - GntR/Others
- By pathway - N-acetylglucosamine utilization
| Genome | Genes | Operons |
|---|---|---|
| Clostridium acetobutylicum ATCC 824 | 3 | 1 |
| Clostridium beijerincki NCIMB 8052 | ||
| Clostridium botulinum A str. ATCC 3502 | 3 | 1 |
| Clostridium butyricum 5521 | ||
| Clostridium kluyveri DSM 555 | ||
| Clostridium novyi NT | ||
| Clostridium perfringens ATCC 13124 | 2 | 1 |
| Clostridium tetani E88 |
| Genes | Function | ||||||||
|---|---|---|---|---|---|---|---|---|---|
| CRON 1. | |||||||||
| nagR |
*
Clostridium acetobutylicum ATCC 824 Site: position = -80 score = 5.93888 sequence = AAATTGGTATATACAACATG Gene: CAC0189: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family |
|
*
Clostridium botulinum A str. ATCC 3502 Site: position = -202 score = 6.18712 sequence = AAATTGGTATATACAACATA Gene: CBO2835: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family |
|
|
|
*
Clostridium perfringens ATCC 13124 Site: position = -57 score = 5.49635 sequence = ATAGTGGTCTAGACAAGTTA Gene: CPF_2745: Transcriptional regulator of N-Acetylglucosamine utilization, GntR family |
|
Transcriptional regulator of N-Acetylglucosamine utilization, GntR family |
| nagA |
Gene: CAC0188: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) |
|
Gene: CBO2834: N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) |
|
|
|
|
|
N-acetylglucosamine-6-phosphate deacetylase (EC 3.5.1.25) |
| nagB |
Gene: CAC0187: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) |
|
Gene: CBO2833: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) |
|
|
|
Gene: CPF_2744: Glucosamine-6-phosphate deaminase (EC 3.5.99.6) |
|
Glucosamine-6-phosphate deaminase (EC 3.5.99.6) |
Bluish color - the gene is in regulated operon. Different regulated operons are shown in different shades of blue.
Red color - the gene is in non-regulated operon.
Gray color - the orthologous gene is absent.
The star symbol - the TFBS is located in upstream region of this gene.
The number - the numeber of homologs (shown only if it is greater than one).
|
Regulated Genes | [ Tab delimited format ] | DOWNLOAD |
|
Regulatory Sites | [ FASTA format ] | DOWNLOAD |