Regulon of FnrN/FixK/AadR in Xanthobacter autotrophicus Py2

Properties
Regulator type:	Transcription factor
TF locus tag:	Xaut_1746
Regulator family:	CRP
Regulation mode:	repressor (activator)
Biological process:	Oxidative stress response; Nitrogen fixation
Effector:	Oxygen
Regulog:	FnrN/FixK/AadR - Rhizobiales
Statistics of regulated genes:
- Genes	14
- Operons	5
Visualization:
	Allows to visualize regulon content in the context of metabolic pathways

Built upon 192 sites [see more]

Member of regulog collections

By taxonomy - Rhizobiales
By trascription factor - FnrN/FixK
By TF family - CRP
By effector - Oxygen
By pathway - Oxidative stress response
By pathway - Nitrogen fixation

Regulated operons
	Locus Tag	Name	Function
Position: -97 Score: 5.2 Sequence: GCTTTGACCTGTATCAAGGA Locus tag: Xaut_0459 Name: ccoN Funciton: Cytochrome c oxidase subunit CcoN (EC 1.9.3.1) Locus tag: Xaut_0460 Name: ccoO Funciton: Cytochrome c oxidase subunit CcoO (EC 1.9.3.1) Locus tag: Xaut_0461 Name: ccoQ Funciton: Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1) Locus tag: Xaut_0462 Name: ccoP Funciton: Cytochrome c oxidase subunit CcoP (EC 1.9.3.1) Locus tag: Xaut_0463 Name: ccoG Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation Locus tag: Xaut_0464 Name: ccoH Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoH Locus tag: Xaut_0465 Name: ccoI Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4) Locus tag: Xaut_0466 Name: ccoS Funciton: Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion Locus tag: Xaut_0467 Name: PF00083 Funciton: Predicted transporter, MFS family
	Xaut_0459	ccoN	Cytochrome c oxidase subunit CcoN (EC 1.9.3.1)
	Xaut_0460	ccoO	Cytochrome c oxidase subunit CcoO (EC 1.9.3.1)
	Xaut_0461	ccoQ	Cytochrome c oxidase subunit CcoQ (EC 1.9.3.1)
	Xaut_0462	ccoP	Cytochrome c oxidase subunit CcoP (EC 1.9.3.1)
	Xaut_0463	ccoG	Type cbb3 cytochrome oxidase biogenesis protein CcoG, involved in Cu oxidation
	Xaut_0464	ccoH	Type cbb3 cytochrome oxidase biogenesis protein CcoH
	Xaut_0465	ccoI	Type cbb3 cytochrome oxidase biogenesis protein CcoI; Copper-translocating P-type ATPase (EC 3.6.3.4)
	Xaut_0466	ccoS	Type cbb3 cytochrome oxidase biogenesis protein CcoS, involved in heme b insertion
	Xaut_0467	PF00083	Predicted transporter, MFS family
Position: -87 Score: 4.9 Sequence: AAATTGACATAAATCAAACT Locus tag: Xaut_1968 Name: ompW Funciton: Outer membrane protein W precursor
	Xaut_1968	ompW	Outer membrane protein W precursor
Position: -107 Score: 5.1 Sequence: CGGTTGACCCGCATCAATGC Locus tag: Xaut_0669 Name: adhP Funciton: Predicted alcohol dehydrogenase (EC 1.1.1.1), zinc containing Locus tag: Xaut_0668 Name: COG2187 Funciton: Predicted kinase
	Xaut_0669	adhP	Predicted alcohol dehydrogenase (EC 1.1.1.1), zinc containing
	Xaut_0668	COG2187	Predicted kinase
Position: -72 Score: 4.3 Sequence: CAGTTGATCGTTGTCAAAAG Locus tag: Xaut_3275 Name: bsr3073 Funciton: Conserved hypothetical protein
	Xaut_3275	bsr3073	Conserved hypothetical protein
Position: -108 Score: 4.4 Sequence: CTCTTGATTGGTATCAATAC Locus tag: Xaut_2126 Name: hemA Funciton: 5-aminolevulinate synthase (EC 2.3.1.37)
	Xaut_2126	hemA	5-aminolevulinate synthase (EC 2.3.1.37)

Export
	Regulated Genes	[ Tab delimited format ]	DOWNLOAD
	Regulatory Sites	[ FASTA format ]	DOWNLOAD